ID: 1058814376

View in Genome Browser
Species Human (GRCh38)
Location 9:108669840-108669862
Sequence CCTTGCCATGACCATTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058814376_1058814382 30 Left 1058814376 9:108669840-108669862 CCACCCCAATGGTCATGGCAAGG No data
Right 1058814382 9:108669893-108669915 GCACCAAACCCACTGACTGCTGG No data
1058814376_1058814381 -5 Left 1058814376 9:108669840-108669862 CCACCCCAATGGTCATGGCAAGG No data
Right 1058814381 9:108669858-108669880 CAAGGTATCAACACTGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058814376 Original CRISPR CCTTGCCATGACCATTGGGG TGG (reversed) Intergenic
No off target data available for this crispr