ID: 1058814379

View in Genome Browser
Species Human (GRCh38)
Location 9:108669844-108669866
Sequence GATACCTTGCCATGACCATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058814379_1058814381 -9 Left 1058814379 9:108669844-108669866 CCCAATGGTCATGGCAAGGTATC No data
Right 1058814381 9:108669858-108669880 CAAGGTATCAACACTGATGCAGG No data
1058814379_1058814382 26 Left 1058814379 9:108669844-108669866 CCCAATGGTCATGGCAAGGTATC No data
Right 1058814382 9:108669893-108669915 GCACCAAACCCACTGACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058814379 Original CRISPR GATACCTTGCCATGACCATT GGG (reversed) Intergenic
No off target data available for this crispr