ID: 1058814381

View in Genome Browser
Species Human (GRCh38)
Location 9:108669858-108669880
Sequence CAAGGTATCAACACTGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058814378_1058814381 -8 Left 1058814378 9:108669843-108669865 CCCCAATGGTCATGGCAAGGTAT No data
Right 1058814381 9:108669858-108669880 CAAGGTATCAACACTGATGCAGG No data
1058814380_1058814381 -10 Left 1058814380 9:108669845-108669867 CCAATGGTCATGGCAAGGTATCA No data
Right 1058814381 9:108669858-108669880 CAAGGTATCAACACTGATGCAGG No data
1058814376_1058814381 -5 Left 1058814376 9:108669840-108669862 CCACCCCAATGGTCATGGCAAGG No data
Right 1058814381 9:108669858-108669880 CAAGGTATCAACACTGATGCAGG No data
1058814379_1058814381 -9 Left 1058814379 9:108669844-108669866 CCCAATGGTCATGGCAAGGTATC No data
Right 1058814381 9:108669858-108669880 CAAGGTATCAACACTGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058814381 Original CRISPR CAAGGTATCAACACTGATGC AGG Intergenic
No off target data available for this crispr