ID: 1058818270

View in Genome Browser
Species Human (GRCh38)
Location 9:108705439-108705461
Sequence CTGCCCTATCTAGTTTCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058818270_1058818274 6 Left 1058818270 9:108705439-108705461 CCACCTGAAACTAGATAGGGCAG No data
Right 1058818274 9:108705468-108705490 GGAAGGACACTGCTTGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058818270 Original CRISPR CTGCCCTATCTAGTTTCAGG TGG (reversed) Intergenic
No off target data available for this crispr