ID: 1058819564

View in Genome Browser
Species Human (GRCh38)
Location 9:108717058-108717080
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058819560_1058819564 22 Left 1058819560 9:108717013-108717035 CCATCAGAGGTACACGGAGGAGA No data
Right 1058819564 9:108717058-108717080 ATTCCAAACAATAGAAAAAGAGG No data
1058819562_1058819564 -6 Left 1058819562 9:108717041-108717063 CCATTCCTTCTGAAACTATTCCA No data
Right 1058819564 9:108717058-108717080 ATTCCAAACAATAGAAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058819564 Original CRISPR ATTCCAAACAATAGAAAAAG AGG Intergenic