ID: 1058819565 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:108717059-108717081 |
| Sequence | TTCCAAACAATAGAAAAAGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1058819560_1058819565 | 23 | Left | 1058819560 | 9:108717013-108717035 | CCATCAGAGGTACACGGAGGAGA | No data | ||
| Right | 1058819565 | 9:108717059-108717081 | TTCCAAACAATAGAAAAAGAGGG | No data | ||||
| 1058819562_1058819565 | -5 | Left | 1058819562 | 9:108717041-108717063 | CCATTCCTTCTGAAACTATTCCA | No data | ||
| Right | 1058819565 | 9:108717059-108717081 | TTCCAAACAATAGAAAAAGAGGG | No data | ||||
| 1058819563_1058819565 | -10 | Left | 1058819563 | 9:108717046-108717068 | CCTTCTGAAACTATTCCAAACAA | No data | ||
| Right | 1058819565 | 9:108717059-108717081 | TTCCAAACAATAGAAAAAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1058819565 | Original CRISPR | TTCCAAACAATAGAAAAAGA GGG | Intergenic | ||