ID: 1058819565

View in Genome Browser
Species Human (GRCh38)
Location 9:108717059-108717081
Sequence TTCCAAACAATAGAAAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058819560_1058819565 23 Left 1058819560 9:108717013-108717035 CCATCAGAGGTACACGGAGGAGA No data
Right 1058819565 9:108717059-108717081 TTCCAAACAATAGAAAAAGAGGG No data
1058819562_1058819565 -5 Left 1058819562 9:108717041-108717063 CCATTCCTTCTGAAACTATTCCA No data
Right 1058819565 9:108717059-108717081 TTCCAAACAATAGAAAAAGAGGG No data
1058819563_1058819565 -10 Left 1058819563 9:108717046-108717068 CCTTCTGAAACTATTCCAAACAA No data
Right 1058819565 9:108717059-108717081 TTCCAAACAATAGAAAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058819565 Original CRISPR TTCCAAACAATAGAAAAAGA GGG Intergenic