ID: 1058820773

View in Genome Browser
Species Human (GRCh38)
Location 9:108727679-108727701
Sequence AGGGAAAGCACAGTGATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058820765_1058820773 26 Left 1058820765 9:108727630-108727652 CCCCATCAGGGGCCATGTGTTGC No data
Right 1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG No data
1058820767_1058820773 24 Left 1058820767 9:108727632-108727654 CCATCAGGGGCCATGTGTTGCAG No data
Right 1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG No data
1058820766_1058820773 25 Left 1058820766 9:108727631-108727653 CCCATCAGGGGCCATGTGTTGCA No data
Right 1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG No data
1058820768_1058820773 14 Left 1058820768 9:108727642-108727664 CCATGTGTTGCAGAGACAGAATC No data
Right 1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG No data
1058820764_1058820773 27 Left 1058820764 9:108727629-108727651 CCCCCATCAGGGGCCATGTGTTG No data
Right 1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058820773 Original CRISPR AGGGAAAGCACAGTGATTGC TGG Intergenic
No off target data available for this crispr