ID: 1058831185

View in Genome Browser
Species Human (GRCh38)
Location 9:108818328-108818350
Sequence CAAAATAGCCACACATGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058831182_1058831185 1 Left 1058831182 9:108818304-108818326 CCAAATCATGAACACAATTCCAT No data
Right 1058831185 9:108818328-108818350 CAAAATAGCCACACATGGCCAGG No data
1058831181_1058831185 13 Left 1058831181 9:108818292-108818314 CCAAGATGAGTGCCAAATCATGA No data
Right 1058831185 9:108818328-108818350 CAAAATAGCCACACATGGCCAGG No data
1058831180_1058831185 23 Left 1058831180 9:108818282-108818304 CCAATAATATCCAAGATGAGTGC No data
Right 1058831185 9:108818328-108818350 CAAAATAGCCACACATGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058831185 Original CRISPR CAAAATAGCCACACATGGCC AGG Intergenic
No off target data available for this crispr