ID: 1058832935

View in Genome Browser
Species Human (GRCh38)
Location 9:108835532-108835554
Sequence CATGAATCACACTGATTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058832930_1058832935 21 Left 1058832930 9:108835488-108835510 CCTGAGGCTATGAGTTAATTGAG No data
Right 1058832935 9:108835532-108835554 CATGAATCACACTGATTCTGTGG No data
1058832929_1058832935 27 Left 1058832929 9:108835482-108835504 CCTCGACCTGAGGCTATGAGTTA No data
Right 1058832935 9:108835532-108835554 CATGAATCACACTGATTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058832935 Original CRISPR CATGAATCACACTGATTCTG TGG Intergenic