ID: 1058833796 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:108842792-108842814 |
Sequence | GTACCTACTACTGTCTCCAA CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1058833796_1058833803 | 28 | Left | 1058833796 | 9:108842792-108842814 | CCGTTGGAGACAGTAGTAGGTAC | No data | ||
Right | 1058833803 | 9:108842843-108842865 | ATGCAGAAACCCCAATCCACAGG | No data | ||||
1058833796_1058833804 | 29 | Left | 1058833796 | 9:108842792-108842814 | CCGTTGGAGACAGTAGTAGGTAC | No data | ||
Right | 1058833804 | 9:108842844-108842866 | TGCAGAAACCCCAATCCACAGGG | No data | ||||
1058833796_1058833797 | 0 | Left | 1058833796 | 9:108842792-108842814 | CCGTTGGAGACAGTAGTAGGTAC | No data | ||
Right | 1058833797 | 9:108842815-108842837 | TGCCTAAATACTGCCCTGATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1058833796 | Original CRISPR | GTACCTACTACTGTCTCCAA CGG (reversed) | Intergenic | ||