ID: 1058833796

View in Genome Browser
Species Human (GRCh38)
Location 9:108842792-108842814
Sequence GTACCTACTACTGTCTCCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058833796_1058833797 0 Left 1058833796 9:108842792-108842814 CCGTTGGAGACAGTAGTAGGTAC No data
Right 1058833797 9:108842815-108842837 TGCCTAAATACTGCCCTGATAGG No data
1058833796_1058833804 29 Left 1058833796 9:108842792-108842814 CCGTTGGAGACAGTAGTAGGTAC No data
Right 1058833804 9:108842844-108842866 TGCAGAAACCCCAATCCACAGGG No data
1058833796_1058833803 28 Left 1058833796 9:108842792-108842814 CCGTTGGAGACAGTAGTAGGTAC No data
Right 1058833803 9:108842843-108842865 ATGCAGAAACCCCAATCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058833796 Original CRISPR GTACCTACTACTGTCTCCAA CGG (reversed) Intergenic