ID: 1058833797

View in Genome Browser
Species Human (GRCh38)
Location 9:108842815-108842837
Sequence TGCCTAAATACTGCCCTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058833796_1058833797 0 Left 1058833796 9:108842792-108842814 CCGTTGGAGACAGTAGTAGGTAC No data
Right 1058833797 9:108842815-108842837 TGCCTAAATACTGCCCTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058833797 Original CRISPR TGCCTAAATACTGCCCTGAT AGG Intergenic