ID: 1058833804

View in Genome Browser
Species Human (GRCh38)
Location 9:108842844-108842866
Sequence TGCAGAAACCCCAATCCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058833796_1058833804 29 Left 1058833796 9:108842792-108842814 CCGTTGGAGACAGTAGTAGGTAC No data
Right 1058833804 9:108842844-108842866 TGCAGAAACCCCAATCCACAGGG No data
1058833800_1058833804 -8 Left 1058833800 9:108842829-108842851 CCTGATAGGTGCCCATGCAGAAA No data
Right 1058833804 9:108842844-108842866 TGCAGAAACCCCAATCCACAGGG No data
1058833798_1058833804 4 Left 1058833798 9:108842817-108842839 CCTAAATACTGCCCTGATAGGTG No data
Right 1058833804 9:108842844-108842866 TGCAGAAACCCCAATCCACAGGG No data
1058833799_1058833804 -7 Left 1058833799 9:108842828-108842850 CCCTGATAGGTGCCCATGCAGAA No data
Right 1058833804 9:108842844-108842866 TGCAGAAACCCCAATCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058833804 Original CRISPR TGCAGAAACCCCAATCCACA GGG Intergenic