ID: 1058835411

View in Genome Browser
Species Human (GRCh38)
Location 9:108855346-108855368
Sequence CAGCCCCGAGGTCTTGCCGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 3, 3: 3, 4: 54}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058835406_1058835411 -9 Left 1058835406 9:108855332-108855354 CCGCTCTCCACCACCAGCCCCGA 0: 1
1: 0
2: 5
3: 56
4: 660
Right 1058835411 9:108855346-108855368 CAGCCCCGAGGTCTTGCCGTAGG 0: 1
1: 0
2: 3
3: 3
4: 54
1058835402_1058835411 26 Left 1058835402 9:108855297-108855319 CCTCGGATATGGGCACCACGTGC 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1058835411 9:108855346-108855368 CAGCCCCGAGGTCTTGCCGTAGG 0: 1
1: 0
2: 3
3: 3
4: 54
1058835405_1058835411 -8 Left 1058835405 9:108855331-108855353 CCCGCTCTCCACCACCAGCCCCG 0: 1
1: 0
2: 7
3: 94
4: 725
Right 1058835411 9:108855346-108855368 CAGCCCCGAGGTCTTGCCGTAGG 0: 1
1: 0
2: 3
3: 3
4: 54
1058835403_1058835411 11 Left 1058835403 9:108855312-108855334 CCACGTGCGAGACGCCGTGCCCG 0: 1
1: 0
2: 0
3: 8
4: 49
Right 1058835411 9:108855346-108855368 CAGCCCCGAGGTCTTGCCGTAGG 0: 1
1: 0
2: 3
3: 3
4: 54
1058835401_1058835411 27 Left 1058835401 9:108855296-108855318 CCCTCGGATATGGGCACCACGTG 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1058835411 9:108855346-108855368 CAGCCCCGAGGTCTTGCCGTAGG 0: 1
1: 0
2: 3
3: 3
4: 54
1058835404_1058835411 -3 Left 1058835404 9:108855326-108855348 CCGTGCCCGCTCTCCACCACCAG 0: 1
1: 0
2: 3
3: 37
4: 432
Right 1058835411 9:108855346-108855368 CAGCCCCGAGGTCTTGCCGTAGG 0: 1
1: 0
2: 3
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058835411 Original CRISPR CAGCCCCGAGGTCTTGCCGT AGG Exonic
901632286 1:10653732-10653754 CAGCCCCGAGATCTTGCTGTTGG + Exonic
902623855 1:17665540-17665562 CAGCACAGAGGTGTTGTCGTTGG + Intronic
908480529 1:64534864-64534886 CAGCCCCCTGGCCTTGCCCTTGG + Intronic
911275343 1:95852923-95852945 CAGGCCCCAAGCCTTGCCGTTGG - Intergenic
920333289 1:205227850-205227872 CAGCCCCGCGGGCTTCCCATTGG + Intergenic
922416460 1:225427519-225427541 CGGCCCCGCGGTCCTGCAGTAGG - Intronic
1063349246 10:5338798-5338820 CAGCCCCCATGTCTTGACCTTGG - Intergenic
1072734015 10:97867097-97867119 CAGCCCCGTTGTCTTGTCATGGG - Exonic
1073658209 10:105441205-105441227 CAGCCCCAAGGTCTTACAGTTGG - Intergenic
1076713691 10:132352746-132352768 CAGCCCCGAGGCCTCCCTGTGGG + Intronic
1076739965 10:132478177-132478199 CAGCCCTGAGGTCTAGCAGGGGG + Intergenic
1078518354 11:12044371-12044393 GTGACCCGTGGTCTTGCCGTGGG + Intergenic
1083708431 11:64532329-64532351 CAGCCCCGATGTCGGGCCCTGGG - Intergenic
1084526821 11:69703261-69703283 CAGCCCCTGCATCTTGCCGTCGG + Exonic
1089452547 11:118608110-118608132 CCGCCCCAAGGTCCTGCTGTGGG - Intronic
1089625159 11:119746421-119746443 CTACCCCCTGGTCTTGCCGTCGG + Intergenic
1096677135 12:53232003-53232025 GAGCCCCGAGGTCCCGGCGTCGG + Exonic
1121432875 14:93899906-93899928 CAGCCCCGAGGGCTTCCCTCTGG - Intergenic
1128796453 15:70470038-70470060 CAGCCCTGAGTTCATGCTGTGGG - Intergenic
1139950155 16:70664581-70664603 CAGCCCCGCGGGCCTGCCTTGGG + Exonic
1203116100 16_KI270728v1_random:1491928-1491950 CAGCCCTGAGGTTTTTCCGCAGG - Intergenic
1143719416 17:8799295-8799317 CAGCCCCCAGGTCCTGCCGTTGG + Exonic
1148052741 17:44777102-44777124 CAGGCCTGAGGTCTTGGGGTGGG + Intronic
1149845401 17:60006572-60006594 GAGCCCCCAGGGCTTGCCGATGG - Intergenic
1150083749 17:62263155-62263177 GAGCCCCCAGGGCTTGCCGATGG - Intergenic
1150251502 17:63707246-63707268 CAGCCCCGAGGTCCTCCAGCAGG - Exonic
1151925587 17:77193828-77193850 CAGCCCCCAGGCCTTGCTGCAGG + Intronic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1161698711 19:5783866-5783888 CAGCCCCGGGGCCTTGAGGTAGG + Exonic
1163014086 19:14443272-14443294 CAGCCCCGAGGGGTTTCCCTGGG + Intronic
1165120600 19:33556287-33556309 GAGCCCTGAGGTCTTGTCCTTGG + Intergenic
1168256091 19:55166159-55166181 CAGCCCCGAGGTCCTGTCTGCGG - Intronic
926087556 2:10029564-10029586 CAGCCCCAAGGCCTTGTTGTAGG + Intergenic
927503683 2:23599170-23599192 CAGCCCAGAGTCCTTGCCGCAGG - Intronic
928086198 2:28347864-28347886 CAGCCCCGGGGCGTTGCCTTGGG + Intergenic
931221943 2:60296135-60296157 CAGCCCCAAAGTCTTCCCATTGG + Intergenic
1176025128 20:62981871-62981893 CAGCCCCGAGGTCTCAGAGTGGG - Intergenic
1183362408 22:37389547-37389569 CAACCCCGAGGTATAGCCCTTGG + Intronic
1184786207 22:46673193-46673215 CAGTCCCCAGGTGTTGCCCTGGG - Intronic
953497807 3:43403467-43403489 CTGCCCTGAGCTCTTGCTGTTGG - Intronic
956111402 3:65873292-65873314 CAGGCCTGAGAGCTTGCCGTGGG - Intronic
961260049 3:125595179-125595201 CAGCCCCGAGGTTAGGCCGCGGG - Intergenic
964344911 3:155745349-155745371 CAGCCCCGAGGGGTTACCCTGGG - Intergenic
968221430 3:196942863-196942885 CAGCCGCGAGGTCCTGCAGGCGG - Intergenic
970116349 4:12700736-12700758 CAGCCCTGATATCTTGCCTTGGG - Intergenic
978566654 4:110089795-110089817 CAGCCCTGAGGTCTTTCCGTTGG - Intronic
996069243 5:119116052-119116074 CATCCCCAAGTTCTTGCCATTGG + Intronic
999282096 5:150372638-150372660 CAGCCCCCCTGTCTTGCCCTTGG - Intronic
1008013288 6:46491088-46491110 CAGCCCCGGGGTCGTGCCGGGGG - Intronic
1013612979 6:111812313-111812335 GAGTCCCGAGGTTTTGCCATGGG - Intronic
1014495672 6:122118649-122118671 CTGCCTCAAGGTCTTGCCCTTGG - Intergenic
1035482440 7:159198198-159198220 CAGGCCCGAGGTCCTCCCGGGGG - Intergenic
1040033102 8:42843546-42843568 CAGCCCCGGGCTGTTCCCGTGGG + Intergenic
1046491029 8:114953148-114953170 GAGCCCAGAGGTTTTGCCATGGG + Intergenic
1049309084 8:141923866-141923888 GAGCCCTGAGGTCTTGCAGCTGG - Intergenic
1049432218 8:142570429-142570451 CAGCCCGGAGGTCTCCCAGTGGG - Intergenic
1057294794 9:93828565-93828587 GAGCCCCTAGGTCTTGGGGTTGG - Intergenic
1058835411 9:108855346-108855368 CAGCCCCGAGGTCTTGCCGTAGG + Exonic
1062100197 9:134724004-134724026 GAGCCCCGAGGTCCTCCCCTCGG + Intronic
1185677650 X:1861633-1861655 CCACACCGAGGTCTTGCAGTGGG + Intergenic
1199847609 X:151702386-151702408 TAGCCCTGAGGACTTGCCCTGGG + Exonic