ID: 1058836179

View in Genome Browser
Species Human (GRCh38)
Location 9:108860205-108860227
Sequence TGGGGGATACAGGAGGGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058836170_1058836179 3 Left 1058836170 9:108860179-108860201 CCAATGTAATCACAAGGGTCCTT 0: 52
1: 263
2: 585
3: 890
4: 1094
Right 1058836179 9:108860205-108860227 TGGGGGATACAGGAGGGTCAAGG No data
1058836166_1058836179 23 Left 1058836166 9:108860159-108860181 CCTGTATGGCCTGGGTGGGGCCA No data
Right 1058836179 9:108860205-108860227 TGGGGGATACAGGAGGGTCAAGG No data
1058836167_1058836179 14 Left 1058836167 9:108860168-108860190 CCTGGGTGGGGCCAATGTAATCA No data
Right 1058836179 9:108860205-108860227 TGGGGGATACAGGAGGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058836179 Original CRISPR TGGGGGATACAGGAGGGTCA AGG Intergenic
No off target data available for this crispr