ID: 1058836310

View in Genome Browser
Species Human (GRCh38)
Location 9:108861269-108861291
Sequence CTAGCCAATGACCCTGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058836306_1058836310 29 Left 1058836306 9:108861217-108861239 CCTAAAAGCCTCAGTGTTGTCAG No data
Right 1058836310 9:108861269-108861291 CTAGCCAATGACCCTGATGAAGG No data
1058836309_1058836310 21 Left 1058836309 9:108861225-108861247 CCTCAGTGTTGTCAGTGGGATTT No data
Right 1058836310 9:108861269-108861291 CTAGCCAATGACCCTGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058836310 Original CRISPR CTAGCCAATGACCCTGATGA AGG Intergenic
No off target data available for this crispr