ID: 1058840516

View in Genome Browser
Species Human (GRCh38)
Location 9:108903218-108903240
Sequence GTGGGGTGGGGGAGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17134
Summary {0: 3, 1: 266, 2: 469, 3: 2261, 4: 14135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058840516 Original CRISPR GTGGGGTGGGGGAGGGTGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr