ID: 1058845043

View in Genome Browser
Species Human (GRCh38)
Location 9:108949155-108949177
Sequence TGCCCAGGAAAACTGCTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058845041_1058845043 -2 Left 1058845041 9:108949134-108949156 CCTGAAGAAGGGCTATAAATCTG 0: 1
1: 0
2: 1
3: 17
4: 180
Right 1058845043 9:108949155-108949177 TGCCCAGGAAAACTGCTACAAGG No data
1058845038_1058845043 11 Left 1058845038 9:108949121-108949143 CCTTAAACAGTAACCTGAAGAAG 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1058845043 9:108949155-108949177 TGCCCAGGAAAACTGCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058845043 Original CRISPR TGCCCAGGAAAACTGCTACA AGG Intronic
No off target data available for this crispr