ID: 1058847460

View in Genome Browser
Species Human (GRCh38)
Location 9:108975273-108975295
Sequence TTTGAGGCATGCCTGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 1, 2: 0, 3: 28, 4: 252}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058847460_1058847482 28 Left 1058847460 9:108975273-108975295 CCCTCCTCCAGGCATGCCTCAAA 0: 1
1: 1
2: 0
3: 28
4: 252
Right 1058847482 9:108975324-108975346 GAGGGGCAGGGGTGGGGGTAGGG No data
1058847460_1058847478 21 Left 1058847460 9:108975273-108975295 CCCTCCTCCAGGCATGCCTCAAA 0: 1
1: 1
2: 0
3: 28
4: 252
Right 1058847478 9:108975317-108975339 AGGGGTTGAGGGGCAGGGGTGGG No data
1058847460_1058847476 17 Left 1058847460 9:108975273-108975295 CCCTCCTCCAGGCATGCCTCAAA 0: 1
1: 1
2: 0
3: 28
4: 252
Right 1058847476 9:108975313-108975335 ATAAAGGGGTTGAGGGGCAGGGG No data
1058847460_1058847480 23 Left 1058847460 9:108975273-108975295 CCCTCCTCCAGGCATGCCTCAAA 0: 1
1: 1
2: 0
3: 28
4: 252
Right 1058847480 9:108975319-108975341 GGGTTGAGGGGCAGGGGTGGGGG No data
1058847460_1058847481 27 Left 1058847460 9:108975273-108975295 CCCTCCTCCAGGCATGCCTCAAA 0: 1
1: 1
2: 0
3: 28
4: 252
Right 1058847481 9:108975323-108975345 TGAGGGGCAGGGGTGGGGGTAGG No data
1058847460_1058847479 22 Left 1058847460 9:108975273-108975295 CCCTCCTCCAGGCATGCCTCAAA 0: 1
1: 1
2: 0
3: 28
4: 252
Right 1058847479 9:108975318-108975340 GGGGTTGAGGGGCAGGGGTGGGG No data
1058847460_1058847475 16 Left 1058847460 9:108975273-108975295 CCCTCCTCCAGGCATGCCTCAAA 0: 1
1: 1
2: 0
3: 28
4: 252
Right 1058847475 9:108975312-108975334 GATAAAGGGGTTGAGGGGCAGGG No data
1058847460_1058847477 20 Left 1058847460 9:108975273-108975295 CCCTCCTCCAGGCATGCCTCAAA 0: 1
1: 1
2: 0
3: 28
4: 252
Right 1058847477 9:108975316-108975338 AAGGGGTTGAGGGGCAGGGGTGG No data
1058847460_1058847470 3 Left 1058847460 9:108975273-108975295 CCCTCCTCCAGGCATGCCTCAAA 0: 1
1: 1
2: 0
3: 28
4: 252
Right 1058847470 9:108975299-108975321 CAGGGAGCAACAGGATAAAGGGG No data
1058847460_1058847468 1 Left 1058847460 9:108975273-108975295 CCCTCCTCCAGGCATGCCTCAAA 0: 1
1: 1
2: 0
3: 28
4: 252
Right 1058847468 9:108975297-108975319 CGCAGGGAGCAACAGGATAAAGG No data
1058847460_1058847472 10 Left 1058847460 9:108975273-108975295 CCCTCCTCCAGGCATGCCTCAAA 0: 1
1: 1
2: 0
3: 28
4: 252
Right 1058847472 9:108975306-108975328 CAACAGGATAAAGGGGTTGAGGG No data
1058847460_1058847474 15 Left 1058847460 9:108975273-108975295 CCCTCCTCCAGGCATGCCTCAAA 0: 1
1: 1
2: 0
3: 28
4: 252
Right 1058847474 9:108975311-108975333 GGATAAAGGGGTTGAGGGGCAGG No data
1058847460_1058847484 30 Left 1058847460 9:108975273-108975295 CCCTCCTCCAGGCATGCCTCAAA 0: 1
1: 1
2: 0
3: 28
4: 252
Right 1058847484 9:108975326-108975348 GGGGCAGGGGTGGGGGTAGGGGG No data
1058847460_1058847483 29 Left 1058847460 9:108975273-108975295 CCCTCCTCCAGGCATGCCTCAAA 0: 1
1: 1
2: 0
3: 28
4: 252
Right 1058847483 9:108975325-108975347 AGGGGCAGGGGTGGGGGTAGGGG No data
1058847460_1058847467 -6 Left 1058847460 9:108975273-108975295 CCCTCCTCCAGGCATGCCTCAAA 0: 1
1: 1
2: 0
3: 28
4: 252
Right 1058847467 9:108975290-108975312 CTCAAAGCGCAGGGAGCAACAGG No data
1058847460_1058847469 2 Left 1058847460 9:108975273-108975295 CCCTCCTCCAGGCATGCCTCAAA 0: 1
1: 1
2: 0
3: 28
4: 252
Right 1058847469 9:108975298-108975320 GCAGGGAGCAACAGGATAAAGGG No data
1058847460_1058847473 11 Left 1058847460 9:108975273-108975295 CCCTCCTCCAGGCATGCCTCAAA 0: 1
1: 1
2: 0
3: 28
4: 252
Right 1058847473 9:108975307-108975329 AACAGGATAAAGGGGTTGAGGGG No data
1058847460_1058847471 9 Left 1058847460 9:108975273-108975295 CCCTCCTCCAGGCATGCCTCAAA 0: 1
1: 1
2: 0
3: 28
4: 252
Right 1058847471 9:108975305-108975327 GCAACAGGATAAAGGGGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058847460 Original CRISPR TTTGAGGCATGCCTGGAGGA GGG (reversed) Intronic
902682257 1:18051635-18051657 TTCCAGGCATGCATGCAGGAAGG - Intergenic
902725142 1:18330533-18330555 TGGGAGACATGGCTGGAGGAAGG + Intronic
902725158 1:18330581-18330603 TGGGAGACATGGCTGGAGGAAGG + Intronic
902725174 1:18330629-18330651 TGGGAGACATGGCTGGAGGAAGG + Intronic
903776864 1:25799390-25799412 CATGCGGCATGCTTGGAGGAGGG - Intergenic
903865225 1:26392889-26392911 TTTGGGGCATGGCTGGGGGAGGG - Intergenic
904379135 1:30099698-30099720 CTGGAGGCGTGCATGGAGGATGG - Intergenic
905500594 1:38433375-38433397 TTTGATGGAAGCCTGCAGGAAGG - Intergenic
906026125 1:42675671-42675693 TTTGAGGAATGGCAAGAGGAGGG + Intronic
906495370 1:46301659-46301681 TTTGAGTTATGCCATGAGGAGGG - Intronic
906562201 1:46767371-46767393 TTAGAGGACTTCCTGGAGGAAGG + Intronic
907385063 1:54120881-54120903 ATTGGGGCATGGCTGGAGGCGGG + Intergenic
907735830 1:57111113-57111135 TTTGAGCCAGACCTGAAGGATGG + Intronic
908601431 1:65744227-65744249 TTTCAGGCATGACTGGGGTACGG + Intergenic
908783688 1:67714633-67714655 AGTGAGGCATGCTAGGAGGAGGG - Intronic
910989369 1:93039127-93039149 TTTGAGTCACAACTGGAGGATGG + Intergenic
911091467 1:94020717-94020739 TTTGAGGCCTACATGGAGGAGGG - Intronic
911368516 1:96969562-96969584 TTTGAGGCATGTATGGAATATGG + Intergenic
912504212 1:110144594-110144616 TGTGAGGCTTGGCTGGAGGCTGG + Intergenic
913589462 1:120309616-120309638 TTTGAGACGTGCCTAGAGGCAGG + Intergenic
913618724 1:120588750-120588772 TTTGAGACGTGCCTAGAGGCAGG - Intergenic
913964828 1:143367610-143367632 TTTAAGGCATCCCAGGATGATGG - Intergenic
914059201 1:144193213-144193235 TTTAAGGCATCCCAGGATGATGG - Intergenic
914119948 1:144773158-144773180 TTTAAGGCATCCCAGGATGATGG + Intergenic
914322322 1:146577133-146577155 TTTGAGGTAGGTGTGGAGGAAGG - Intergenic
914571484 1:148921474-148921496 TTTGAGACGTGCCTAGAGGCAGG + Intronic
914601348 1:149208788-149208810 TTTGAGACGTGCCTAGAGGCAGG - Intergenic
915464797 1:156090754-156090776 TTGGAGGCATGTCTGGAAGTTGG + Intronic
915626028 1:157114708-157114730 TTGGGGGGGTGCCTGGAGGAGGG + Intergenic
915669820 1:157479034-157479056 GCTGAGGCATGCCTGGAGGCTGG + Intergenic
915901332 1:159848570-159848592 GTTGGGGCCTGCCTGGAGGCAGG - Intronic
916714144 1:167435340-167435362 TTGGAGGAAGGGCTGGAGGAGGG - Intronic
917617303 1:176759149-176759171 TTTTATGAATGCCTGGGGGAGGG + Intronic
918269953 1:182888760-182888782 CTTGAGGCAGGCCTGTAGGCAGG - Intergenic
919346453 1:196385851-196385873 TTTGGGGCAATCCTGGAGGCTGG - Intronic
919819809 1:201465849-201465871 TTTGTGCCAGGCCTGGAGGAGGG - Exonic
920974546 1:210773583-210773605 TTTGAGCAAAGCCTGGAGAAAGG - Intronic
921290712 1:213654562-213654584 TTTGAGACATTCCTGGAGCATGG - Intergenic
1065299742 10:24310648-24310670 TTAGAGGCACACCTGGAGCAAGG - Intronic
1067158911 10:43806183-43806205 TCAGAGCAATGCCTGGAGGAAGG - Intergenic
1067842089 10:49688984-49689006 TTGGAGGCATGCTTTGAGGAGGG + Intronic
1069719623 10:70541267-70541289 TTAGAGATTTGCCTGGAGGAGGG + Intronic
1070838725 10:79468508-79468530 TGTGAGGCCTTCTTGGAGGAAGG + Intergenic
1071985597 10:91047163-91047185 TCTGAGGCAGGCTGGGAGGAGGG - Intergenic
1072607639 10:96997930-96997952 TTGGAGCCATCCCTGGATGATGG + Intergenic
1073520925 10:104128346-104128368 TTTGAGGCATGGATGGAGTGGGG - Intergenic
1075741154 10:124697387-124697409 TTTAAGGCCTGGCAGGAGGATGG + Intronic
1076421802 10:130337178-130337200 TTTGAGCCAATCCTGAAGGAAGG - Intergenic
1077347140 11:2066822-2066844 TTTGAGGCATTCCTGTAGAGTGG - Intergenic
1077538486 11:3135548-3135570 TCTGGGGCTAGCCTGGAGGAGGG - Intronic
1078197618 11:9149498-9149520 TGTTATGCATGCCTGGAAGAGGG + Intronic
1078908601 11:15710495-15710517 CATGAGTCCTGCCTGGAGGAGGG + Intergenic
1081621016 11:44619193-44619215 TGGGAGGCAGGCCTGGAGGAGGG - Exonic
1082768817 11:57189781-57189803 TTTCAGGCTTTCCAGGAGGATGG - Exonic
1082820117 11:57538925-57538947 TTTGTGACAAGCCTGGAGGGTGG + Intergenic
1083746752 11:64741364-64741386 CTTCAGGCTGGCCTGGAGGAGGG - Intronic
1084452955 11:69250946-69250968 TTTGAGGCATGCCTGCTCCAGGG + Intergenic
1086503190 11:87474304-87474326 TCTGAGGCATGTGAGGAGGAAGG + Intergenic
1086790204 11:91027831-91027853 TCTAGGGCTTGCCTGGAGGATGG + Intergenic
1087657247 11:100939107-100939129 TTTAATGCATGCCTCGAGGTGGG - Intronic
1088144324 11:106656869-106656891 TTTGGGGCATGCTTGCATGAGGG + Intergenic
1088441422 11:109875057-109875079 TTTGAGACCTGCTTTGAGGAAGG - Intergenic
1089009626 11:115121922-115121944 TTTGATGGTGGCCTGGAGGAGGG + Intergenic
1089166774 11:116483532-116483554 TATGAGGTATGCCTGGGGGATGG + Intergenic
1089342257 11:117766059-117766081 TTTGTCGAATGCCTAGAGGAAGG - Intronic
1090156662 11:124445289-124445311 TTTAAGAAATGCCTGGAAGAGGG - Intergenic
1090476835 11:127030279-127030301 TTTGAGAGATGCCTAGAAGAAGG + Intergenic
1090869036 11:130726562-130726584 TTTCAGGAAACCCTGGAGGAGGG - Intergenic
1092429563 12:8397697-8397719 TTGGAGGCATGCCCTGATGAAGG + Intergenic
1092704286 12:11267321-11267343 CTTGTGGCCTTCCTGGAGGAGGG + Exonic
1096697474 12:53359137-53359159 TTAGAGGCATTCCTGGAGCTGGG + Intergenic
1099965445 12:89440452-89440474 TGTGAGGAATGGCTGGGGGAAGG + Intronic
1101801062 12:108022281-108022303 TTGGATGCATGCATGGATGATGG - Intergenic
1101946505 12:109141245-109141267 TTTCAGGCATCACTGGGGGAAGG - Intronic
1102199791 12:111049353-111049375 ATGGATGCATGCATGGAGGAAGG - Intronic
1102661458 12:114532390-114532412 TTTCAGGCATGGTTGCAGGAAGG + Intergenic
1103982727 12:124746951-124746973 TTGGAGGACTTCCTGGAGGAGGG + Intergenic
1103993351 12:124813917-124813939 TTGGAGGCTTTGCTGGAGGAAGG - Intronic
1104627066 12:130366280-130366302 TTTGAAGTGAGCCTGGAGGAGGG + Intronic
1106547486 13:30743219-30743241 TTTGAGGCATGCAAGAAGGTGGG - Intronic
1107672594 13:42761395-42761417 TTTGAGGAATGCCTTGAGATAGG - Intergenic
1107797323 13:44065847-44065869 TTTGAGCCAGTCCTGAAGGAAGG - Intergenic
1110575403 13:77049192-77049214 TGTGAGCCATGCTTGGAGGGAGG - Intronic
1112036399 13:95500559-95500581 TTTCAGGAATGTGTGGAGGAAGG + Intronic
1112126421 13:96473316-96473338 TTTGATACATGCCTGGAATATGG - Intronic
1112449806 13:99498495-99498517 TTTGTGGCCTGCGTGGAGGGCGG + Intergenic
1113196418 13:107812888-107812910 GGTGATGCATGCCTGTAGGAAGG - Intronic
1114538354 14:23437050-23437072 AGTGAGGCAGGCCTGGGGGATGG + Intergenic
1115147453 14:30241635-30241657 TTTGAGTCATGCAAGGAGAAAGG - Intergenic
1116946212 14:50837541-50837563 TTCCACGCATTCCTGGAGGACGG - Intergenic
1121179841 14:91920726-91920748 TTGGAGGCTTGCCAGGAGGAGGG - Intronic
1122206646 14:100150975-100150997 TTAGGGGCATGCCTGTTGGATGG - Intronic
1122746306 14:103899098-103899120 TTTGAAGGAAGCCTGGAGCAAGG - Intergenic
1122774950 14:104113011-104113033 TTGGAGGGCTGCCTGGGGGAGGG - Exonic
1124090528 15:26595707-26595729 TTAGAGGCATTCCTGGAACAGGG - Intronic
1124364447 15:29062174-29062196 TCTGAGGCATGGCTGCAGAAAGG - Intronic
1124993950 15:34704415-34704437 ATTGAGCCATACCTGCAGGAAGG + Intergenic
1125094012 15:35830037-35830059 ATTGATGCCTCCCTGGAGGAGGG - Intergenic
1125367519 15:38933840-38933862 TTTGTGGCAACCCTGTAGGAAGG - Intergenic
1125798815 15:42426003-42426025 TTAGGTGCATGCCTGGAGTAAGG + Intronic
1126291176 15:47081314-47081336 TTAGAGCAATGCATGGAGGAAGG - Intergenic
1127530824 15:59841864-59841886 TTTGAGTCATGGATGGGGGAAGG - Intergenic
1128261947 15:66238725-66238747 TTTAAGTTATACCTGGAGGAGGG - Intronic
1130298965 15:82665952-82665974 GTTGAGGCACTGCTGGAGGAGGG + Intronic
1133253777 16:4503314-4503336 TTTGGGGCAGGGCTGGGGGAGGG - Intronic
1133321016 16:4913969-4913991 ACTGAGGCAGGCCTGGAGGCTGG + Intronic
1133704153 16:8337380-8337402 TTTGAGGCTTTCCTGGAGGCTGG + Intergenic
1135653190 16:24225115-24225137 TTAGAGTCCTGCCTGAAGGAGGG - Intergenic
1136020556 16:27437354-27437376 TTTGAGGCAGGGCTGGGGGGTGG - Intronic
1136370245 16:29831573-29831595 TTTGGGGCATGTGTGGAGGATGG - Intronic
1136617356 16:31406632-31406654 TTGGAGGCACCCATGGAGGAAGG - Intronic
1137703614 16:50518014-50518036 GTTAAGGCATGCCTGGAGCCTGG + Intergenic
1137942175 16:52699067-52699089 GTTTAGGCATGGCTGGAGCAAGG + Intergenic
1138234849 16:55373634-55373656 CCTGAGGTCTGCCTGGAGGAGGG - Intergenic
1139112268 16:63905180-63905202 TGTGAGGTTTGCCTGGAGGCTGG + Intergenic
1140011303 16:71134035-71134057 TTTGAGGTAGGTGTGGAGGAAGG + Intronic
1140063470 16:71590654-71590676 CTTGAGGCCTCCCTGGGGGATGG - Intergenic
1142245953 16:88970083-88970105 TGGGAGGCAGGCCTGGGGGAGGG + Intronic
1142846860 17:2685270-2685292 CTTTAGGGATGCCTGAAGGATGG - Exonic
1142887011 17:2919232-2919254 TCTGAGCCAGACCTGGAGGAAGG + Intronic
1143550244 17:7626337-7626359 GCTGAGGCCTCCCTGGAGGAAGG - Exonic
1145013986 17:19385107-19385129 TTTGTGGCAGGCTTTGAGGATGG - Exonic
1145243052 17:21250915-21250937 TGTAAGGCAAGCCTGGAGGCTGG - Intronic
1145765925 17:27457990-27458012 TTTGTGGCATGCCTGGAGGAAGG - Intronic
1146468993 17:33109514-33109536 TTTGAGTCATCCCTGGGAGATGG - Intronic
1147652093 17:42068554-42068576 TTTGAGGCCAGCCTGGAGCCTGG - Intergenic
1148203591 17:45765873-45765895 TTTGTGTGATGCCTGGAGGGTGG + Intergenic
1151383550 17:73741654-73741676 ATTGAGGTCTGCCTGGATGAGGG + Intergenic
1156512880 18:37655781-37655803 TTTGAGTAATCCCTGGAGGCAGG - Intergenic
1157144050 18:45143055-45143077 CGTGCTGCATGCCTGGAGGAGGG - Intergenic
1157499151 18:48177905-48177927 TCTGAGGCCTCCCTGGAGAAAGG - Intronic
1157561227 18:48647927-48647949 TGTGAGGCAACCTTGGAGGATGG + Intronic
1157589223 18:48826256-48826278 CTTGAGCCATGCCTGGAACACGG - Intronic
1159280539 18:66279193-66279215 ATTGAGACATACCTGAAGGATGG + Intergenic
1159703048 18:71654072-71654094 TTTGAGGTCTGCCTAAAGGATGG + Intergenic
1160086555 18:75781986-75782008 GTGGAGGCTTGCCTGGATGATGG - Intergenic
1160335410 18:78034307-78034329 TTTGAAGCATGCCTGAAGAATGG + Intergenic
1161098089 19:2405381-2405403 CTTGCAGCCTGCCTGGAGGATGG + Exonic
1161703613 19:5807543-5807565 AATGGGGCATGCCTGCAGGAAGG + Intergenic
1162336281 19:10062424-10062446 CTTGAGGTATGTCTTGAGGAGGG - Intergenic
1163332106 19:16646216-16646238 TTGGAGGTAAACCTGGAGGAAGG - Exonic
1165757520 19:38302894-38302916 TCTGGGCCATGCCGGGAGGAAGG + Intronic
1166559010 19:43719706-43719728 GTTGAGGCAGCCCTGGAGCATGG - Exonic
1166778696 19:45328307-45328329 TTTGAGGAGTGCATGGGGGAGGG - Intergenic
1168636295 19:57999845-57999867 GTGGAGGGAAGCCTGGAGGAGGG - Exonic
1202698604 1_KI270712v1_random:145100-145122 TTTAAGGCATCCCAGGATGATGG - Intergenic
925592019 2:5519381-5519403 TTGGAGGCCTGCCAGGAGCAGGG + Intergenic
926147813 2:10407323-10407345 TTTTAGGAATTGCTGGAGGAAGG - Intronic
928361434 2:30665120-30665142 TCTGAAGCATTCCTGGGGGATGG + Intergenic
929124493 2:38510915-38510937 TTGAAGGCATTTCTGGAGGATGG - Intergenic
934279851 2:91602882-91602904 TTTAAGGCATCCCAGGATGATGG - Intergenic
935067039 2:99658278-99658300 CCTGAAGGATGCCTGGAGGAGGG + Intronic
935714717 2:105929746-105929768 GCTGAGGCATGGCTGGAAGAGGG - Intergenic
935943437 2:108265233-108265255 TTTCAGGGATGCCTGGAGACTGG + Exonic
936237901 2:110760623-110760645 TTTGAGGATTGCCTAGAGGTAGG + Intronic
936520767 2:113210692-113210714 TTTGGGGCAAGTCTGGAAGACGG + Intergenic
936590260 2:113796868-113796890 TTAGAGGCATTCCTGGAACAGGG - Intergenic
936818364 2:116487725-116487747 TTTCAGGCATCCCTGAAGGATGG + Intergenic
941517792 2:166501193-166501215 TTTGAGGAATGCCTTCAGCATGG + Intergenic
944212214 2:197218336-197218358 TTTCAGACATCCCTGGAGAATGG - Intronic
944345995 2:198666472-198666494 TTTGAGACCTGCCTGGGGCATGG + Intergenic
948585535 2:239016566-239016588 TTGGGGGCCTGCCTGGAGGGTGG - Intergenic
1169685732 20:8268968-8268990 ATTGAGGCAGTCTTGGAGGAAGG + Intronic
1172441293 20:34968512-34968534 TGGGAGGCCAGCCTGGAGGATGG - Intergenic
1172606363 20:36216839-36216861 GTTAAGGGATGCCTGGAGGGGGG + Intronic
1173388249 20:42608447-42608469 TTTGGGGCAGGGCAGGAGGAAGG + Intronic
1173857463 20:46259647-46259669 ATGGAGGGCTGCCTGGAGGAGGG + Intronic
1174752185 20:53122670-53122692 TCTGGGCCATGCTTGGAGGATGG + Intronic
1175247311 20:57589864-57589886 CTGGAGGCATTCCTGGGGGAGGG - Intergenic
1175657728 20:60786677-60786699 TGTGAGGCAGCCCTGGAAGAGGG - Intergenic
1175761423 20:61564367-61564389 TTGGAGGCAGGCCTGGTGGAGGG + Intronic
1176668904 21:9713585-9713607 TGTGAGGCATCCCTAGAGGAGGG + Intergenic
1178765470 21:35446653-35446675 TTTGGTGAATTCCTGGAGGAAGG - Intronic
1181508252 22:23376256-23376278 TGTTAGGCATGATTGGAGGAGGG + Intergenic
1181594137 22:23903385-23903407 TCTGAGGCATGAATGGAGGAGGG + Intergenic
1183061419 22:35338599-35338621 TTCCAGGCAGGCCTGGAGGATGG + Intronic
1184348949 22:43930709-43930731 TCTGAGCCATGCCAGGGGGATGG + Intronic
1184748683 22:46472032-46472054 TGGGAGGAATGCCTGGAGCACGG - Intronic
950297977 3:11848301-11848323 TTTGAGCCAGGCCTGGAAGCTGG + Intergenic
950688773 3:14638952-14638974 CTTCAGGCATGCCTGGATGTAGG + Intergenic
951688420 3:25370602-25370624 GTAGAGGCAGGCCTGGAGAATGG + Intronic
953062194 3:39436183-39436205 TTTGCGGGGTGGCTGGAGGACGG - Intergenic
954283416 3:49600887-49600909 TGTATGGCATGCATGGAGGAGGG + Intronic
954430234 3:50466941-50466963 CTGGAGGGATTCCTGGAGGAGGG + Intronic
957062521 3:75493694-75493716 TTTGAGTCCTGCCAGGCGGAGGG + Intergenic
960583409 3:119299445-119299467 TTTGAGGCATGACAGAGGGAAGG + Intronic
961000588 3:123371623-123371645 TCTCAGCCAGGCCTGGAGGATGG + Intronic
963703808 3:148660454-148660476 CTTGAGGCAGGCTTGGAGGCTGG + Intergenic
964424210 3:156534447-156534469 TTTAAGGCATGTGGGGAGGAGGG - Intronic
965879773 3:173374630-173374652 ACTGGTGCATGCCTGGAGGAAGG - Intergenic
966834750 3:184040554-184040576 TTGTGGACATGCCTGGAGGACGG - Intergenic
967051773 3:185791589-185791611 TGTGATGCACACCTGGAGGAAGG - Intronic
968885072 4:3324546-3324568 TTTCAGCCATTCATGGAGGATGG + Intronic
969030905 4:4212955-4212977 TTTAAGGCATCCCAGGATGACGG + Exonic
969703773 4:8781358-8781380 TTCCCGGCATGCCAGGAGGAGGG + Intergenic
969838599 4:9863831-9863853 TTGGAGGCATTCCTGGACGTGGG - Intronic
970841207 4:20471793-20471815 AGTGTGGCTTGCCTGGAGGAAGG - Intronic
972320080 4:37965296-37965318 TTTGAACCATGCCTGGTGCATGG + Intronic
973209110 4:47595859-47595881 TTTGTGAGAAGCCTGGAGGACGG - Exonic
975634715 4:76436134-76436156 CTGGAGGCATTCCTGGAGGGAGG + Exonic
977165516 4:93690293-93690315 TCTGAGGCAGGTGTGGAGGAAGG + Intronic
979938226 4:126724547-126724569 TTAGACAGATGCCTGGAGGATGG - Intergenic
981615660 4:146640528-146640550 CTCGAGCCATGCCTGCAGGATGG - Exonic
981841159 4:149113940-149113962 TTGGAGGCAGAGCTGGAGGATGG + Intergenic
983940592 4:173531238-173531260 TAAGAGGCAGGCCGGGAGGACGG + Intergenic
984510962 4:180678221-180678243 TTTGAGGTATGTCTGGGGGAAGG - Intergenic
984615772 4:181895872-181895894 TTTGAGGCGGGCATGGTGGAGGG - Intergenic
985405879 4:189637928-189637950 TGTGAGGCATCCCTAGAGGAGGG - Intergenic
986709827 5:10480585-10480607 TCGCTGGCATGCCTGGAGGATGG - Intergenic
988786422 5:34569460-34569482 TTTGTGGTCTGCCTGGAAGATGG + Intergenic
988854922 5:35219077-35219099 TGTGAGGCCTTCCTGGAGGGGGG + Intronic
991234217 5:64375588-64375610 TTTCAGGGATGCCCGGAGTAAGG - Intergenic
991656117 5:68905378-68905400 TTTGAGGCATGCGAGGAGTGGGG + Intergenic
995079459 5:108031546-108031568 CTTGAGGCATTTCTGGTGGAAGG + Intronic
995861459 5:116645007-116645029 ATTGAAGGATGCCTGGATGATGG - Intergenic
997439257 5:133897748-133897770 TATAAGGCATGCATGGAGGAAGG - Intergenic
998136008 5:139675009-139675031 TCTGAGGCCTTCCTGGAGGAAGG - Intronic
1000670953 5:164062429-164062451 TTTAATGCATGCCTGCAGGATGG + Intergenic
1002440194 5:179260328-179260350 TTTGAGGAATGCCTGGCACACGG - Intronic
1002704201 5:181149167-181149189 TTTGCAGCCTCCCTGGAGGATGG - Intergenic
1003298376 6:4854267-4854289 TCTGAGCCATGCCTGCAAGACGG - Intronic
1004435811 6:15592499-15592521 TTTAGGGAATGCCTGAAGGAGGG - Intronic
1004462961 6:15855504-15855526 TTTGCGGCATCCCTGGAGTGTGG + Intergenic
1004707374 6:18136931-18136953 TTTTAGGCATGCAAGGAGGATGG + Intronic
1005310094 6:24550863-24550885 TTTGAGGCATTAATGGATGAGGG - Intronic
1006609638 6:35286433-35286455 TGGGAGGCAGGACTGGAGGATGG + Intronic
1007178603 6:39912852-39912874 TGTGGGGCAGGCCTGGAGGAAGG - Intronic
1007330505 6:41103307-41103329 TTTGAGGCAAGGTTGGGGGATGG + Intergenic
1009373458 6:62938181-62938203 TTTTAGGCCTGACTGGAGCAAGG - Intergenic
1014910821 6:127090980-127091002 GTTGATGCATGACTGGAGAACGG - Intergenic
1015190116 6:130463338-130463360 TGTCAGGCATTCCTGGAGCACGG + Intergenic
1015320797 6:131871706-131871728 TTTGAGGGATGGATGGATGATGG + Intronic
1017161404 6:151369229-151369251 CTTTAGGCAGGCCTGGAGGGAGG + Intronic
1017209186 6:151836032-151836054 TTTGAGGAATGATTGGAGGCAGG + Intronic
1017255778 6:152331541-152331563 TCTGAGCCATATCTGGAGGAGGG + Exonic
1018952442 6:168387845-168387867 TCTGAGGCAGGCCTGGTGGCCGG - Intergenic
1019346322 7:532535-532557 TTTCAGGCATGGCTGGATCAGGG + Intergenic
1019657283 7:2202620-2202642 TTTGGGGCATGGGAGGAGGAGGG - Intronic
1019694927 7:2440128-2440150 TTTCAGGCATGCCTGCGGAATGG - Intergenic
1019943254 7:4307823-4307845 AATGAGGCAGGCCTGGAGGATGG + Intergenic
1023472748 7:40542373-40542395 TGTGAGGTATCCCTGGAGAAAGG - Intronic
1028381691 7:90207390-90207412 TTTGGGGGATTCCTGTAGGAAGG - Intronic
1029164398 7:98576882-98576904 TTGCATGCATGCCTGGATGAGGG - Intergenic
1032198834 7:129805098-129805120 GATGAAGCAGGCCTGGAGGATGG + Intergenic
1032439948 7:131934946-131934968 TCTGAGACAACCCTGGAGGAGGG + Intergenic
1033728463 7:144147318-144147340 ACTGAGGCATGCCTGAAGGCTGG - Intergenic
1036811319 8:11868876-11868898 TTTGGGGAGTGTCTGGAGGAGGG - Intronic
1037652706 8:20853343-20853365 TTTGTGGTAGGCATGGAGGAGGG - Intergenic
1039026556 8:33264665-33264687 TTTGGGGCAAGGCAGGAGGATGG + Intergenic
1039330864 8:36535180-36535202 TTTGAGACATCCCTGCTGGATGG - Intergenic
1039864032 8:41485487-41485509 TTTGAGGCATGACTGGGGTGGGG - Intergenic
1043361062 8:79472781-79472803 TTTTAGGCATGCCTTAAGAAAGG - Intergenic
1044340483 8:91040960-91040982 TGGGAGGCATGGCTGGGGGAGGG + Exonic
1048093030 8:131261715-131261737 TTAAAGTCATGCATGGAGGATGG + Intergenic
1048336186 8:133504148-133504170 TATGATGCAGGACTGGAGGAGGG - Intronic
1048458194 8:134597484-134597506 TCTGAGGGCTGTCTGGAGGAAGG - Intronic
1049453331 8:142674676-142674698 CTTGGGGCATGGCTGGGGGAAGG - Intronic
1049544921 8:143226100-143226122 AGGGAGGCCTGCCTGGAGGAGGG + Intergenic
1050022045 9:1294343-1294365 TTTGAGCCAGGCATGGAGGGTGG - Intergenic
1051067585 9:13123098-13123120 TCTGAGGCCTGGCTGAAGGACGG + Intronic
1053098723 9:35351578-35351600 TCTGGGGAAAGCCTGGAGGAGGG - Intronic
1056602434 9:88056580-88056602 TTTGTGGCCAGCATGGAGGAGGG + Intergenic
1057592452 9:96383880-96383902 TTCCAGGAAAGCCTGGAGGAAGG - Intergenic
1057711477 9:97449597-97449619 TTGGAGGGCTGCCTGGAGGGTGG - Intronic
1058847460 9:108975273-108975295 TTTGAGGCATGCCTGGAGGAGGG - Intronic
1059413326 9:114147972-114147994 TTTCAGCCATGAATGGAGGAAGG + Intergenic
1059419531 9:114182438-114182460 TTTGAGCCAGGCCTGAAGGATGG + Intronic
1060186295 9:121566151-121566173 CTCCAGGCCTGCCTGGAGGAGGG - Intergenic
1060742853 9:126111017-126111039 GCTGAGGCCTGCCTGGAGCATGG + Intergenic
1060793660 9:126501288-126501310 GTCCAGGCCTGCCTGGAGGATGG - Intronic
1062524627 9:136973271-136973293 TTTGAGGCAACCCAGGGGGATGG - Intergenic
1203656962 Un_KI270753v1:7350-7372 TGTGAGGCATCCCTAGAGGAGGG - Intergenic
1185825549 X:3245704-3245726 TTAGAGGCATGCCTGGAACTAGG + Intergenic
1187074186 X:15917559-15917581 TTTGAGGCATGAGTGGAGAAAGG - Intergenic
1188106823 X:26156442-26156464 TTTTAGCCATGACTGGAGCAGGG + Intergenic
1189995645 X:46634602-46634624 TTTGAAGCATGCCTTCAAGAAGG - Intronic
1192141327 X:68649248-68649270 TTCCAGGCATGCCTGGCAGAGGG + Intronic
1196887988 X:120265434-120265456 TCTGAGGAATGCATGAAGGAAGG + Intronic
1198586929 X:138132157-138132179 ATAGAGGCTTGGCTGGAGGAAGG + Intergenic
1199329570 X:146543088-146543110 TTTGAGCCATGGCTGGAGCTGGG + Intergenic
1200700474 Y:6397958-6397980 TTTGAGGCATCTCTGGGTGATGG + Intergenic
1201033638 Y:9766740-9766762 TTTGAGGCATCTCTGGGTGATGG - Intergenic