ID: 1058850180

View in Genome Browser
Species Human (GRCh38)
Location 9:109004256-109004278
Sequence TAGGGTAATGTTTAGGAGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058850180_1058850184 7 Left 1058850180 9:109004256-109004278 CCGTACTCCTAAACATTACCCTA 0: 1
1: 0
2: 1
3: 15
4: 214
Right 1058850184 9:109004286-109004308 GTACAACAATCCAGTGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058850180 Original CRISPR TAGGGTAATGTTTAGGAGTA CGG (reversed) Intronic
900019601 1:180121-180143 TAGGGTTAGGGTTAGGATTAGGG - Intergenic
900019659 1:180309-180331 TAGGGTTATGGTTAGGGTTAAGG - Intergenic
903010374 1:20325757-20325779 AAGGGTCATGTTTAGCAGAATGG - Intronic
904954753 1:34273568-34273590 TGGGGTAGTGTTTAAGAGTATGG + Intergenic
910054531 1:83016365-83016387 AAGGGTAATGTTCAGGATCAGGG - Intergenic
910182012 1:84494875-84494897 TAGAGGAAAGTTTAGGAGTCTGG + Intronic
913123027 1:115759236-115759258 TATGGTAGTGTTCAGCAGTAGGG + Intronic
913575730 1:120172488-120172510 TAGCATAATGCTTAGGAGTAGGG - Intronic
914402609 1:147337301-147337323 TAGGGGAATCTTAAGGAATATGG + Intergenic
914558044 1:148788060-148788082 TAGCATAATGCTTAGGAGTAGGG - Intergenic
914614790 1:149342170-149342192 TAGCATAATGCTTAGGAGTAGGG + Intergenic
916693947 1:167218409-167218431 TAGTGTAGTGGTTAAGAGTACGG + Intergenic
917328157 1:173854636-173854658 CAGGGTAGTGGTTAGGAGCATGG - Intronic
918137339 1:181686111-181686133 TAGGGTACTGACTAGGAGTCAGG - Intronic
918380996 1:183955104-183955126 TAGGATAATGGTTAAGAGGAAGG + Intronic
918447166 1:184627325-184627347 TAGAAAAATGTTTAGGAGAAAGG + Exonic
922547039 1:226465656-226465678 TAGGGTTATGGTTAGGGTTAAGG - Intergenic
1062765832 10:64328-64350 TAGGGTAAGGGTTAGGGCTAAGG - Intergenic
1063218358 10:3944017-3944039 TAGGGTTAGGTTTAGGGTTAGGG - Intergenic
1065627026 10:27640231-27640253 TACGTCAATGTTTAGAAGTAAGG + Intergenic
1068946751 10:62737019-62737041 TAAGGTAATGTTGAGGATTCGGG + Intergenic
1070428974 10:76317049-76317071 TAGAGTAATGGTCAGGAGAAGGG + Intronic
1073772703 10:106752756-106752778 CAGGGTAATGCTAAGGAGAATGG + Intronic
1076976219 11:175361-175383 TAGGGTTAGGTTTAGGGTTAGGG - Intronic
1076976279 11:175560-175582 TAGGGTTAGGGTTAGGATTAGGG - Intronic
1076976389 11:175919-175941 TAGGGTAAGGGTTAGGGTTAGGG - Intronic
1077840847 11:5972959-5972981 TAAGAGAATGTTTAGGAGGATGG - Intergenic
1077848504 11:6051248-6051270 TACGGAAATGTTTAAGAGAATGG - Intergenic
1078657020 11:13250901-13250923 TATTGTAATATTTATGAGTAGGG - Intergenic
1079356188 11:19731981-19732003 AAGGATAATGATTAAGAGTATGG + Intronic
1079954137 11:26841858-26841880 TAGAGTCATGTTTAAGAGGATGG - Intergenic
1080115822 11:28620719-28620741 TAGGGTTATGTTTAGTACCACGG - Intergenic
1081884755 11:46485247-46485269 TAGTGAAATGTTTAAGAGTTTGG - Intronic
1082586372 11:54946734-54946756 TAGGAGAATGTTGAGGACTATGG - Intergenic
1083435281 11:62638840-62638862 TGGGGAAAGGTTGAGGAGTATGG + Intronic
1083454907 11:62772012-62772034 TAGAGTAAAGATTAGGAGCAAGG + Intronic
1083493216 11:63028212-63028234 TAGGGTTAGGGTTAGGATTAGGG + Intergenic
1086921812 11:92595965-92595987 TTGGGCAATGTTTGTGAGTATGG + Intronic
1088152646 11:106764362-106764384 TAGGGTAATGGTTACGAGCATGG + Intronic
1091297634 11:134485265-134485287 TAGTGCAATGCTTAAGAGTAAGG - Intergenic
1091373133 12:10275-10297 TAGGGTTAGGGTTAGGGGTAGGG - Intergenic
1092243404 12:6849506-6849528 TAGGATAATGTTTTGGGATAAGG - Intronic
1093264377 12:16984523-16984545 TATGGTTATATTGAGGAGTAAGG - Intergenic
1093553862 12:20447628-20447650 TAGGGTGAAGTATAGGAGAAGGG - Intronic
1097949381 12:65410327-65410349 TAGGGAAATGGTTAGGAGCATGG + Intronic
1098265693 12:68716746-68716768 TAGTGTGATGTGTAGGAGTTTGG + Intronic
1099983522 12:89635472-89635494 TAGGGTACTAGTTAAGAGTAAGG + Intronic
1100207062 12:92362304-92362326 TAGTGTAATGTTTAACAGCATGG + Intergenic
1101016841 12:100510692-100510714 TGGCGTAATGGTTAGGAGTGTGG - Intronic
1101190521 12:102327692-102327714 TAAGGTATTGTTAAGGAATATGG + Intergenic
1101518093 12:105455823-105455845 GAAGGTAGTCTTTAGGAGTAAGG - Intergenic
1104087181 12:125486339-125486361 TAGTGTATTGGTTATGAGTAAGG + Intronic
1104503610 12:129309992-129310014 TTGGGAAATGCTTAGGAGTCTGG - Intronic
1105072196 12:133241364-133241386 TAGGGTGATGGTTAGGGTTAGGG + Intergenic
1105940792 13:25146217-25146239 TAGGGTAAAGTATGGGAGAAGGG - Intergenic
1107018807 13:35731005-35731027 TAGGGTGAGGTTTGGGAGAAGGG + Intergenic
1107149978 13:37099729-37099751 TAGGGTGATGTGTGGGAGAAGGG + Intergenic
1107687666 13:42920282-42920304 TAGGGTAATTTTGGGGAGAATGG - Intronic
1107720640 13:43244877-43244899 AAGTGTGATGTTTAAGAGTAGGG - Intronic
1110288797 13:73780141-73780163 TAGGATATTGTTTAAGAGTGTGG - Intronic
1110391731 13:74982354-74982376 TAGGGTAATGTTTAAATATATGG + Intergenic
1112092657 13:96098511-96098533 TGGGGTAATGTTTAAAAGCATGG + Intronic
1112992449 13:105530545-105530567 TAGGGAAATGTTTAACAGTGGGG - Intergenic
1113178241 13:107593065-107593087 GAGGGTAATTTTTAGAATTAAGG + Intronic
1113646380 13:111999512-111999534 TAGGGTTAGGATTAGGATTAAGG - Intergenic
1114296799 14:21337146-21337168 GAGTGTAATGTTTAAGAGCATGG + Intronic
1114332691 14:21653314-21653336 TAAGGTAATCTTTATAAGTAAGG - Intergenic
1114772577 14:25445015-25445037 TAGGGTAAGGTATGGGAGAAAGG - Intergenic
1115343946 14:32322186-32322208 TTTGGGAATGTTCAGGAGTAAGG + Intergenic
1115499480 14:34036511-34036533 TAGCATAATGGTTAGGAGCAGGG - Intronic
1118585003 14:67344237-67344259 TATGGGAAAGTTTAGGAGAAGGG - Intronic
1118773849 14:68961377-68961399 AATGGTTATGTTTAGGAGAAAGG + Intronic
1121804134 14:96799794-96799816 CAGGGTTATTTTTCGGAGTAAGG + Intronic
1124897790 15:33793186-33793208 TAGGGAAATGTATGGGTGTAGGG + Intronic
1125279655 15:38030318-38030340 TAGGGTAATGCCTAGGATCATGG - Intergenic
1126886345 15:53155193-53155215 TAGGGTAAAGATTAGTAGTGTGG + Intergenic
1129919011 15:79302571-79302593 TAGGGTAATTCTTGGGAGAAGGG + Intergenic
1131652321 15:94414178-94414200 TAGGGAAATGTTCAGAAGAAAGG - Intronic
1140722144 16:77781566-77781588 TTGGGTAATGTTTTGTTGTAGGG + Intergenic
1141977203 16:87524749-87524771 TAGGGTTATGATTAGGATTATGG + Intergenic
1141977245 16:87524973-87524995 TAGGGTTAGGGTTAGGATTAGGG + Intergenic
1142443994 16:90122161-90122183 TAGGGTTATGGTTAGGGTTAAGG + Intergenic
1142444048 16:90122333-90122355 TAGGGTTAGGGTTAGGATTAGGG + Intergenic
1142444058 16:90122364-90122386 TAGGGTTAGGGTTAGGATTAGGG + Intergenic
1145264140 17:21371435-21371457 GAGGGTATGGTATAGGAGTAGGG + Intergenic
1145826596 17:27881662-27881684 CATGGGAATGTTTAGGGGTAAGG - Intronic
1148545443 17:48515216-48515238 AGGGGTAGTGTTGAGGAGTAGGG + Intergenic
1151200889 17:72467431-72467453 GAGCGAAATGTTTAGGAGTTGGG - Intergenic
1152952535 18:10020-10042 TAGGGTTAGGGTTAGGGGTAAGG - Intergenic
1152952748 18:10598-10620 TAGGGTTAGGGTTAGGGGTAGGG - Intergenic
1152964788 18:105230-105252 TAGGGTTAGGTTTAGGGTTAGGG - Intergenic
1154202992 18:12312361-12312383 CAGTGTAATGGTTAGGAGTCTGG + Intronic
1158265959 18:55661009-55661031 TAGTGTAATGGTTAAGAGCATGG - Intronic
1160632893 18:80258729-80258751 TAGGGGTAGGTTTAGGGGTAGGG + Intergenic
1160632931 18:80258834-80258856 TAGGGTTAGGGTTAGGGGTAGGG + Intergenic
1160632937 18:80258852-80258874 TAGGGTTATGGTTAGGGGTAGGG + Intergenic
1160632950 18:80258888-80258910 TAGGGGTAAGTTTAGGGGTAGGG + Intergenic
1167404245 19:49293789-49293811 CAGGGTCATTGTTAGGAGTAGGG + Intronic
927801141 2:26100969-26100991 TAGGGTAAAGTGTTGGAGAATGG + Intronic
928390237 2:30904034-30904056 TAGGGTAATGTTTTTAAGCAAGG + Intergenic
930177902 2:48318603-48318625 TAGGTTAAGGTTTTTGAGTATGG - Intronic
930431099 2:51277573-51277595 TAGGGTAATTTTTAGGAGTTTGG - Intergenic
933150915 2:78913941-78913963 TAGTGTAATAATTAAGAGTATGG + Intergenic
933292009 2:80448286-80448308 TAGGGTGATGCTTAGCAATAAGG + Intronic
936569671 2:113603143-113603165 TAGGGTTATGGTTAGGGTTAAGG - Intergenic
936571862 2:113624539-113624561 TAGGGTTAGGGTTAGGATTAGGG - Intergenic
937507885 2:122557435-122557457 TAGGGTAATGATGAGGATAAAGG + Intergenic
937546355 2:123026329-123026351 TAAGGTATTTTTTAGGAGGAAGG - Intergenic
941041661 2:160629880-160629902 GAGGGTACTGTTTGTGAGTAAGG + Intergenic
942252501 2:174059538-174059560 TAAGGAAGTGTTTGGGAGTATGG - Intergenic
943295675 2:186135154-186135176 TAGTGTAATTTTTAGGAGTTGGG + Intergenic
944356291 2:198792337-198792359 TAGGGAAATGTTTAGTGGTACGG + Intergenic
944406142 2:199385792-199385814 TAGGTCAAAGGTTAGGAGTAAGG + Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
944756568 2:202768365-202768387 TAGTGTAATGTTTGGTTGTAAGG + Exonic
944836122 2:203581668-203581690 TAGGGTCAGGTTAAGGACTATGG - Intergenic
945026111 2:205621358-205621380 TATGGGAATGTGTAGGAGGAAGG - Intergenic
947579060 2:231300702-231300724 TAGGGCAGTGGTTAGGAGCATGG - Intronic
948833651 2:240613513-240613535 TAGGGTTATGGTTAGGATTTGGG - Intronic
948833661 2:240613565-240613587 TAGGGTTATGGTTAGCATTAGGG - Intronic
948833719 2:240613886-240613908 TAGTGTTATGGTTAGGGGTAAGG - Intronic
1169313961 20:4572466-4572488 GATGGGAATGTTTAGAAGTATGG - Intergenic
1170398579 20:15955359-15955381 TTGGGTATTGTTCAGGTGTAAGG + Intronic
1173728558 20:45313296-45313318 GAGGGTAAGGATTAGGATTAGGG - Intronic
1176278413 20:64287118-64287140 AAGGGTAAGGGTTAGGATTAGGG + Intronic
1176278453 20:64287234-64287256 AAGGGTAAGGGTTAGGATTAGGG + Intronic
1176278470 20:64287288-64287310 TAGGGTTAGGGTTAGGATTAGGG + Intronic
1177322793 21:19544306-19544328 TAGGGTAAGGTATGGGAGAAAGG - Intergenic
1179197109 21:39174576-39174598 TTTGGTAATGATTAGAAGTATGG - Intergenic
1179915304 21:44473729-44473751 AAGGGTATTGATTAGGAGTGTGG + Intergenic
1184458984 22:44626525-44626547 TAGGGTTAGGGTTAGGATTAGGG + Intergenic
1185428333 22:50786348-50786370 TAGGGTTAGGGTTAGGATTAGGG + Intergenic
949089333 3:10596-10618 TAGGGTTAGGGTTAGGGGTAGGG - Intergenic
949554037 3:5137061-5137083 TAGGGTAATGTTTAAGTATGTGG + Intronic
950708374 3:14797869-14797891 AAGGGCAATGTTCAGGAGAAAGG - Intergenic
952085482 3:29815422-29815444 TACTATAATGTTTAAGAGTATGG + Intronic
952239451 3:31515380-31515402 CAGTGTAATGATTAAGAGTATGG - Intergenic
952486412 3:33816167-33816189 TAGGAGAAAGTTTTGGAGTAGGG + Intronic
953672271 3:44973262-44973284 TAAGGTGATGGTTAGGAGTATGG + Intronic
953787577 3:45922496-45922518 TAGGGCAGTGGTTAGGAGAATGG - Intronic
956145345 3:66186192-66186214 GAGGGTCATGTTTAGGATAAGGG - Intronic
957023385 3:75150434-75150456 TAGGGTAATGCTTTTGACTAAGG + Intergenic
957550438 3:81697267-81697289 TAGGGTAAGGTATGGGAGAAAGG + Intronic
957749175 3:84389858-84389880 TAGGGTAATGTTACAGATTATGG - Intergenic
957902474 3:86512815-86512837 TAGGTAAATGTTGAGGATTAAGG - Intergenic
959373402 3:105558087-105558109 TAGGGTCATGCCCAGGAGTATGG - Intronic
959789046 3:110334869-110334891 TAGGGAAATCTTTAGTAGAATGG + Intergenic
964464950 3:156981650-156981672 TAGGATTAAGTTGAGGAGTATGG + Intronic
966075620 3:175933623-175933645 TAGTGTAATGATAAGGTGTAGGG - Intergenic
966403932 3:179575605-179575627 TAAACTGATGTTTAGGAGTAGGG - Intronic
966626354 3:182021317-182021339 TAGGGGAATGGTTAAGAGCATGG - Intergenic
968364286 3:198173190-198173212 TAGGGTTATGGTTAGGGTTAAGG + Intergenic
968364318 3:198173283-198173305 TAGGGTAAGGATTAGGGTTAGGG + Intergenic
968364683 3:198174486-198174508 TAGGGTTAGGGTTAGGATTAGGG + Intergenic
968364688 3:198174504-198174526 TAGGGTTAGGTTTAGGGTTAGGG + Intergenic
968456950 4:705036-705058 TAGGGTCAGGATTAGGGGTAGGG - Intergenic
972712433 4:41610777-41610799 TAGGGTAATGGTTAAGAGAATGG - Intronic
972888086 4:43517878-43517900 TGGGGTAATATTTGGGAGGAGGG - Intergenic
976814384 4:89130281-89130303 TAAGGTTATGTTTAGAAGAATGG - Intergenic
977955588 4:103021881-103021903 TGGGGTAATATTAGGGAGTAAGG - Intronic
980371147 4:131873646-131873668 TAGAGCAATTTTTAGCAGTATGG - Intergenic
981653075 4:147080995-147081017 TAGGGTAATGTTTAATAAAATGG - Intergenic
984102661 4:175503824-175503846 TTGGGCCATGTTTAGGAGTTTGG - Intergenic
985467041 5:10472-10494 TAGGGTTAGGGTTAGGATTAGGG - Intergenic
990951155 5:61299769-61299791 GAGTGTAATGTTTAAAAGTAAGG + Intergenic
991455561 5:66799768-66799790 TAGAGTAATGTTTAAGAGCATGG + Intronic
992861188 5:80911893-80911915 AAAGGTAATTTTTAGGAGAAAGG + Intergenic
993827449 5:92709245-92709267 AATGGTAAGGTTTTGGAGTATGG - Intergenic
993981005 5:94543719-94543741 TAGGATTAAGTTTAGGATTAAGG + Intronic
994879559 5:105471252-105471274 TTTGGTAATATTTAGCAGTAAGG + Intergenic
1002754648 6:147935-147957 TAGGGTTAGGGTTAGGATTAGGG - Intergenic
1006686260 6:35836944-35836966 AAGGGTAATGTTTCTGAGGATGG + Intronic
1007141026 6:39575068-39575090 TTGGGTAATGTTTAGTTCTAAGG + Intronic
1007641520 6:43343985-43344007 TTGGTTAATGTTCAGGAGTAAGG + Intronic
1010541051 6:77092811-77092833 TAAGGTAATGTGGAAGAGTATGG + Intergenic
1011982809 6:93404421-93404443 CAGGGTATTGGTTAGGAATAAGG + Intronic
1013032224 6:106344756-106344778 CAGGGTAATGTTTTGAAGAAGGG + Intergenic
1013313453 6:108919047-108919069 TAGGGTAATGTATGGGATTCTGG + Intronic
1015948209 6:138524404-138524426 TAGGGTAATGGTTATGTGTGGGG - Intronic
1016465606 6:144322060-144322082 CAGGGTAGTGATTAAGAGTATGG - Intronic
1017263132 6:152410970-152410992 TAGGATAATGTTTAATAATATGG + Intronic
1019250869 7:10104-10126 TAGGGTTAGGTTTAGGGTTAGGG - Intergenic
1019251512 7:16404-16426 TAGGGTTAGGGTTAGGATTAGGG - Intergenic
1019251522 7:16435-16457 TAGGGTTAGGGTTAGGATTAGGG - Intergenic
1019251582 7:16635-16657 TAGGGTTATGGTTAGGGTTAAGG - Intergenic
1019579891 7:1756393-1756415 TAGGGTTAGGTTTAGGCTTATGG - Intergenic
1020732329 7:11896517-11896539 TAAGGTAATGTTTATTAATACGG - Intergenic
1023452042 7:40296849-40296871 TAGAGTAGTGGTTAGGAGCATGG + Intronic
1031329694 7:120449383-120449405 TAGGGTAATGTGGATAAGTATGG - Intronic
1033149874 7:138904730-138904752 TAGGGTGAGGTTTAGAAGCAAGG - Intronic
1033178587 7:139151460-139151482 TAGGGTAGTGATTATGAGTTTGG + Intronic
1035512681 8:205268-205290 TAGGGTTAGGGTTAGGATTAGGG - Intergenic
1035512733 8:205432-205454 TAGGGTTAGGGTTAGGAGTTAGG - Intergenic
1039408464 8:37332321-37332343 TAAGGTATTGTTTAGGACTTAGG - Intergenic
1043187170 8:77167956-77167978 AGGGGTCATGTTTAGGAGAATGG + Intergenic
1043823067 8:84892255-84892277 AAAGGAAATGTTTAAGAGTATGG + Intronic
1045388765 8:101694600-101694622 TAGGGTGCTGTCTAGGATTATGG + Intronic
1045915137 8:107460269-107460291 GAGGGGACTGTTAAGGAGTAGGG + Intronic
1046000596 8:108416847-108416869 TAAAGTAATTTTTAGGATTATGG + Intronic
1048776433 8:137951909-137951931 TAGTATAATGTTTAAGAGCATGG - Intergenic
1051000739 9:12279139-12279161 TAGGGTAAAGAGGAGGAGTAAGG - Intergenic
1053153588 9:35757661-35757683 AAGGGTAGGTTTTAGGAGTAGGG + Exonic
1055128084 9:72742752-72742774 AATGGTAATGTTTTGGACTAAGG - Intronic
1056287194 9:85101448-85101470 TAGGGTCATGGGTAGGAGGAAGG - Intergenic
1056461876 9:86816616-86816638 TAGGGTACTGGTAGGGAGTAGGG + Intergenic
1058568776 9:106317452-106317474 TAGGATAAATTTTAAGAGTATGG + Intergenic
1058850180 9:109004256-109004278 TAGGGTAATGTTTAGGAGTACGG - Intronic
1061364613 9:130165413-130165435 TAGGGTTAGGTTTAGGGTTAAGG - Intergenic
1062670197 9:137704289-137704311 TAGGGGAATGTGTGGGAGGAAGG + Intronic
1062748981 9:138237150-138237172 TAGGGTTATGGTTAGGGTTAAGG + Intergenic
1062749043 9:138237352-138237374 TAGGGTTAGGGTTAGGATTAGGG + Intergenic
1185839466 X:3375264-3375286 TAGGGTTAGGGTTAGCAGTAGGG - Intergenic
1188024926 X:25198162-25198184 CAGGGTAGTGTGGAGGAGTAGGG + Intergenic
1189654374 X:43226687-43226709 TAAGGTAAATTTTAGGAGGAGGG - Intergenic
1190983745 X:55482092-55482114 GAGGGAAGTGTGTAGGAGTAAGG + Intergenic
1191676399 X:63796185-63796207 CAGGGTAATGGTTATGGGTATGG - Intergenic
1194574706 X:95597369-95597391 TAAGGTAATGTTTTGCTGTATGG - Intergenic
1194876368 X:99193543-99193565 TAGGATAATGGTTGGGAATAAGG - Intergenic
1196159607 X:112468350-112468372 TAAGGTACTATGTAGGAGTATGG - Intergenic
1196588401 X:117457805-117457827 TAGAGGAATATTTAGGAGTGTGG + Intergenic
1196910173 X:120476916-120476938 TAGTGTCATGGTTAGGAGCAGGG - Intergenic
1198836968 X:140815861-140815883 TAGGGTAATGTTCTGGAGGAAGG + Intergenic
1198942357 X:141970514-141970536 TACGGTAATGTTTGGGATTTTGG - Intergenic
1199570237 X:149260304-149260326 TAAGGTAAGGTATAAGAGTAGGG - Intergenic
1200392112 X:155955082-155955104 TAGGGTTAAGTTTAGGGGTTAGG + Intergenic
1201754128 Y:17468174-17468196 TTGGTTAATGGTTAGGATTATGG + Intergenic
1201847424 Y:18437811-18437833 TTGGTTAATGGTTAGGATTATGG - Intergenic
1202335969 Y:23811441-23811463 TAAGGTAAGGTTTAGGATTCAGG + Intergenic
1202336047 Y:23811971-23811993 TGGGGTAAGGATTAGGAATAGGG + Intergenic
1202534719 Y:25858096-25858118 TGGGGTAAGGATTAGGAATAGGG - Intergenic
1202534797 Y:25858626-25858648 TAAGGTAAGGTTTAGGATTCAGG - Intergenic