ID: 1058850392

View in Genome Browser
Species Human (GRCh38)
Location 9:109006427-109006449
Sequence AAGAGTGTAGGTAGCTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058850392_1058850396 20 Left 1058850392 9:109006427-109006449 CCAGGGGAGCTACCTACACTCTT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1058850396 9:109006470-109006492 TACCTTCCAGGATTATGTTAAGG No data
1058850392_1058850399 27 Left 1058850392 9:109006427-109006449 CCAGGGGAGCTACCTACACTCTT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1058850399 9:109006477-109006499 CAGGATTATGTTAAGGATCAAGG No data
1058850392_1058850394 8 Left 1058850392 9:109006427-109006449 CCAGGGGAGCTACCTACACTCTT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1058850394 9:109006458-109006480 CACCGTCTCTCTTACCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058850392 Original CRISPR AAGAGTGTAGGTAGCTCCCC TGG (reversed) Intronic
900969758 1:5984907-5984929 AAGAGTGAAGCCAGCTGCCCAGG - Intronic
901097814 1:6696473-6696495 AAGAGTAGAGGAAGGTCCCCTGG - Intronic
912556751 1:110521776-110521798 AAGAGTGAAGGCTGATCCCCTGG - Intergenic
919161735 1:193839390-193839412 GAGAAGGTAGGTAGCTCCCTAGG - Intergenic
1063027624 10:2197218-2197240 AATAGTGAAGGTAGCTCTTCAGG + Intergenic
1074361369 10:112826116-112826138 AAGAGGGTAGGTGGCTCACCAGG - Intergenic
1076123195 10:127952652-127952674 TAGTGTGTAGGTCCCTCCCCCGG - Intronic
1076145316 10:128114257-128114279 AGGAGTGTAGGAAGCTCCCGAGG + Intronic
1076542791 10:131224614-131224636 GAGAGTTCAGGTAACTCCCCAGG - Intronic
1078665116 11:13318061-13318083 AAGAGTGGTGGTCCCTCCCCTGG + Intronic
1092062197 12:5560503-5560525 AAAAGTCTAGATAGCTCCACAGG + Intronic
1095555212 12:43494604-43494626 AAGAGTGGAGGTAGCCCCAGTGG + Intronic
1104577775 12:129983597-129983619 CTGAGTGTGGGCAGCTCCCCTGG + Intergenic
1107082885 13:36393947-36393969 AAAAGAGTAGCTAGCTCCCCAGG - Intergenic
1107200225 13:37706381-37706403 AATAGTCTAGGCAGCTTCCCAGG + Intronic
1108894405 13:55306321-55306343 AAGAGTCTGGTTAGCTTCCCTGG + Intergenic
1121113559 14:91328658-91328680 GAGAGTGTATGTAGCAGCCCTGG - Intronic
1123989993 15:25676059-25676081 CTGAGTGTGGGAAGCTCCCCTGG + Intergenic
1127399718 15:58573687-58573709 AAGACTGTTGAAAGCTCCCCAGG + Intergenic
1129312297 15:74721227-74721249 AAGAGTGTCGGAAGGTCTCCAGG + Exonic
1133775323 16:8890768-8890790 AGTGGTGTAGGTAGGTCCCCTGG - Intergenic
1138607260 16:58097219-58097241 AAGGGGGTAGGTAGCCCCCAAGG - Intergenic
1139251962 16:65505288-65505310 AAGAGGGTGTGGAGCTCCCCTGG - Intergenic
1142138002 16:88460366-88460388 AAGATGGCAGGCAGCTCCCCAGG - Intronic
1149012836 17:51875188-51875210 AAGAGTATAAGCAGCTCTCCTGG - Intronic
1151296993 17:73193031-73193053 AAGGGCGTAGGTAGATCGCCGGG + Exonic
1156134260 18:34017710-34017732 GAGAGTGTAGGCAGCTCCAATGG - Intronic
1159422925 18:68246924-68246946 AAGAGTGTAGGAAGAATCCCTGG + Intergenic
1159612831 18:70545857-70545879 CAGAGTTTAGTTAGCTCCACTGG - Intergenic
1161548407 19:4896544-4896566 AAGGGTGTTGGCAGCTTCCCAGG - Intronic
1162367643 19:10259071-10259093 AAGAGTCTAGCTCTCTCCCCAGG - Intronic
1166985594 19:46658715-46658737 AAGAGTGTGGTTAGGACCCCTGG + Intronic
1167998556 19:53426304-53426326 TAGAGTGCAGGGAGATCCCCTGG + Intronic
1168008678 19:53512415-53512437 TAGAGTGCAGGGAGATCCCCTGG + Intergenic
929338188 2:40778284-40778306 GAGAGTGTAGGTAGATGCGCAGG + Intergenic
936609560 2:113988576-113988598 AAGAGTGTAGGTGGTCTCCCAGG + Intergenic
940855628 2:158726682-158726704 ATGAATGGAGGTAGCTCCCATGG + Intergenic
1172175937 20:32971961-32971983 AAGAGGGCAGGCTGCTCCCCAGG + Intergenic
1179894164 21:44352038-44352060 CAGACTGCAGGTGGCTCCCCAGG - Intronic
1180223395 21:46374449-46374471 AAGCGTGTTGGTAGATCCACAGG + Intronic
1181056185 22:20261528-20261550 CAGAGGGTAGGTGGCTCCCCGGG + Intronic
1182665226 22:31953745-31953767 CAGAGTGGAGGCAGCACCCCTGG + Intronic
1184263780 22:43335345-43335367 ATGACTGTAAGTAGGTCCCCAGG + Intronic
950192333 3:10986230-10986252 AAGAGAGTAAGCAGCTCACCAGG + Intergenic
952153907 3:30622252-30622274 AAGAGTGAAGTTAGCCTCCCTGG - Intronic
954712317 3:52511320-52511342 AAGTGTGTAGGTACCTGCCAAGG - Intronic
956833639 3:73077562-73077584 AACAGTGTAGGTCTTTCCCCAGG + Intergenic
962251695 3:133839811-133839833 AACAGTGCAAGTGGCTCCCCAGG - Intronic
962881908 3:139586451-139586473 AAGAGTGTAGGCTGCCCCCCTGG + Intronic
965986324 3:174758033-174758055 AATAGTGTTGGTAACTCTCCAGG - Intronic
968450710 4:674778-674800 CCGAGTGCAGGTGGCTCCCCGGG + Intronic
969411309 4:7030107-7030129 AGGAGTGCAGCTAGCTCACCAGG + Intronic
970974600 4:22028886-22028908 TACAGTGTAGGGAGCTCCTCTGG - Intergenic
973149222 4:46866414-46866436 AAAAGAATAGGTAGCTCTCCAGG - Intronic
973694619 4:53477961-53477983 AAGAGGGTAGGTAGCTCAGATGG - Intronic
977175002 4:93808943-93808965 AAGTGTCTAGGTATCTCCCTTGG - Intergenic
981918058 4:150056496-150056518 AAGAGTCAAGTTAGCTCCACTGG + Intergenic
982315739 4:154029959-154029981 AAGAGTGAAGGCAGCTTCACAGG + Intergenic
984577919 4:181472821-181472843 AAGAGTGTAGGTAACTTCCTAGG - Intergenic
989779766 5:45249953-45249975 AAGAGTGTAGGGAGCTGCAGGGG - Intergenic
992367772 5:76110837-76110859 ATGAGTGTTGGGAGTTCCCCAGG + Intronic
993915859 5:93741919-93741941 AAGAGGTTAGGTAGCTCCTGGGG - Intronic
1001316029 5:170641834-170641856 AGGAGTGCAGGGAGCTTCCCGGG + Intronic
1002053918 5:176587615-176587637 GAGAGGGTAGGCAGCTCTCCAGG - Intronic
1003368844 6:5505261-5505283 AAGAGCGAAGGAAGCTCCCAGGG - Intronic
1015059436 6:128945019-128945041 AAGAGTGGAGGTAGCTCTGAAGG + Intronic
1018927195 6:168214734-168214756 AAGAGTGTGAACAGCTCCCCTGG - Intergenic
1020926246 7:14329665-14329687 AAGGTGGTAGATAGCTCCCCAGG - Intronic
1021022640 7:15622895-15622917 AAGAGGCTAGGTAGCTCTCTGGG - Intronic
1021838562 7:24704305-24704327 AATAGTGGAGGAAGCTTCCCAGG + Intronic
1028650706 7:93147595-93147617 GAGGGTGTGGGTAGCTCTCCTGG - Intronic
1031392485 7:121232570-121232592 AAGAGTGAATTTATCTCCCCAGG + Intronic
1032147308 7:129395678-129395700 AAGAGTGTAGGGAAGTGCCCAGG + Intronic
1034150176 7:148909035-148909057 ATGAGTGTAGGTAGATTCCTAGG - Intergenic
1035353619 7:158264351-158264373 TGGAGTGAAGGTAGCTTCCCAGG + Intronic
1043179071 8:77060837-77060859 AAGAGTGAAGACATCTCCCCAGG - Intergenic
1044306178 8:90644155-90644177 AAGAGTTTATGTAGATTCCCAGG - Intronic
1048919250 8:139212971-139212993 AAGGGTTTAGGTAACTTCCCAGG + Intergenic
1055361291 9:75493420-75493442 AAGGGTGTAGGAAGAGCCCCAGG - Intergenic
1057035986 9:91811889-91811911 GAGTGTGTGGGGAGCTCCCCTGG - Intronic
1057457308 9:95226485-95226507 AGGAGTGAGGGTAGCTGCCCAGG + Intronic
1058769857 9:108219983-108220005 AAGAGTTTAGCTGGGTCCCCTGG - Intergenic
1058850392 9:109006427-109006449 AAGAGTGTAGGTAGCTCCCCTGG - Intronic
1058891741 9:109367006-109367028 GAGAGTTTAGGTAGCTTACCAGG + Intergenic
1059692707 9:116700853-116700875 CAGAGTGTAGATATCTACCCAGG + Exonic
1060353626 9:122882552-122882574 AAGAGTGTAGGTTGCTGGCTGGG - Intronic
1060451235 9:123742644-123742666 AAAAGTGCAGACAGCTCCCCAGG + Intronic
1187038659 X:15569563-15569585 AAGAGTGTTTAAAGCTCCCCAGG - Intronic
1195032445 X:100939418-100939440 AAGTGTGTAGGTAGCTATCGTGG + Intergenic
1199713499 X:150489377-150489399 AAGAGTCAAGGTAGCTTCCTTGG + Intronic
1200229911 X:154438683-154438705 CAGGGTGGAAGTAGCTCCCCAGG + Intronic