ID: 1058850393

View in Genome Browser
Species Human (GRCh38)
Location 9:109006439-109006461
Sequence GGTGTAGTGATTAAGAGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 1, 2: 5, 3: 45, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058850393_1058850399 15 Left 1058850393 9:109006439-109006461 CCTACACTCTTAATCACTACACC 0: 1
1: 1
2: 5
3: 45
4: 247
Right 1058850399 9:109006477-109006499 CAGGATTATGTTAAGGATCAAGG No data
1058850393_1058850394 -4 Left 1058850393 9:109006439-109006461 CCTACACTCTTAATCACTACACC 0: 1
1: 1
2: 5
3: 45
4: 247
Right 1058850394 9:109006458-109006480 CACCGTCTCTCTTACCTTCCAGG No data
1058850393_1058850396 8 Left 1058850393 9:109006439-109006461 CCTACACTCTTAATCACTACACC 0: 1
1: 1
2: 5
3: 45
4: 247
Right 1058850396 9:109006470-109006492 TACCTTCCAGGATTATGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058850393 Original CRISPR GGTGTAGTGATTAAGAGTGT AGG (reversed) Intronic
903608896 1:24595572-24595594 AGTGCAGAGGTTAAGAGTGTGGG + Intronic
903695951 1:25207107-25207129 GGTGTAGTGGTTAAGAGCATGGG - Intergenic
903945218 1:26958677-26958699 GGGGTAGTGGATAAGAGTCTGGG - Intronic
904549398 1:31302968-31302990 GGTATAGTGCTTAAGAATGCAGG + Intronic
905657401 1:39693599-39693621 TGTGTACTGATTAGGAGTGTGGG - Intronic
905661917 1:39734105-39734127 GGTGAAATGAATAGGAGTGTGGG - Intronic
906094858 1:43215948-43215970 GGTATAGTGATTAAGGGAGGGGG - Intronic
906620914 1:47278007-47278029 GGTGTAAGGGTTAAGAGAGTGGG - Intronic
907059577 1:51407911-51407933 GGAGTAGTGATTAAGAGTGTGGG - Intronic
907714647 1:56915784-56915806 GGTGTAATGTTTAAGAGATTGGG - Intronic
907762545 1:57375648-57375670 AGTGTGGTGGTTAAGAGAGTGGG - Intronic
909699189 1:78501720-78501742 AGTGTAGTTATTCAGAGTATAGG + Intronic
909699229 1:78502316-78502338 AGTGTAGTGTTTAAGAATCTGGG + Intronic
909890515 1:81000434-81000456 TGTGTAGTGATATAGAATGTAGG - Intergenic
910124667 1:83827364-83827386 GGTGTAGTGGTTATGAGCCTGGG - Intergenic
912380686 1:109246626-109246648 AGTGTACTGCTTAAGAGAGTGGG + Intergenic
912642201 1:111358017-111358039 AGTGCAGTGGTTAAGAGTTTAGG - Intergenic
914747198 1:150509438-150509460 GCTGTGGAGATCAAGAGTGTAGG - Intronic
916228409 1:162514106-162514128 TGTGTAGCGGTTAAGAGTGTAGG + Intronic
916340088 1:163723854-163723876 TCTGCAGTGATTAAGAGGGTGGG - Intergenic
916992480 1:170259244-170259266 GGCATAGTGATTAAAAGTCTGGG + Intergenic
917426775 1:174922748-174922770 AATGTAGTGGTTAAAAGTGTGGG + Intronic
919329470 1:196151764-196151786 GGTAAAGTGATTAAGAGTGTGGG - Intergenic
919365323 1:196652816-196652838 GGAGTAGTGAATATGAATGTAGG + Intronic
919941802 1:202292273-202292295 TGTGTAGTAGCTAAGAGTGTGGG + Intronic
922441674 1:225660660-225660682 GGTGCAGAGGTTAAGAGTGTGGG - Intergenic
924125828 1:240849981-240850003 GGTGTTGTGATAAAGAGTATGGG + Intronic
924816947 1:247451104-247451126 GGTGAAGGGATTGAGAGTGGGGG + Exonic
1065219825 10:23485298-23485320 AGTGTAGTGGATAAGAGTGCAGG - Intergenic
1065712039 10:28528036-28528058 AGTATAGTGATTAAAAGCGTGGG - Intergenic
1068920586 10:62479070-62479092 GGAGAAGAGATTAAGGGTGTTGG - Intronic
1069500426 10:68948211-68948233 AGTGCAGTGGTTAAGAGTGCTGG - Intergenic
1069564970 10:69457676-69457698 AGTTTAATGGTTAAGAGTGTGGG + Intronic
1070370497 10:75777644-75777666 GGTCTAGCGGTTAAGAGTGCTGG + Intronic
1072772134 10:98150956-98150978 GGTGTAGTGATTGTGAGTCGGGG + Intronic
1073062470 10:100740891-100740913 GGTCTAGAGAGTAAGAGTGAAGG - Intronic
1074616579 10:115075003-115075025 AGTGTGGTGGTGAAGAGTGTGGG - Intergenic
1077797055 11:5503865-5503887 ATTGCAGTGATTAAGAGTATGGG + Intronic
1077950046 11:6946938-6946960 GGTTTATTGATTAAAACTGTAGG + Intronic
1078938437 11:15973734-15973756 GGGGTTGGGATTAAGAGAGTTGG + Intronic
1078956760 11:16206464-16206486 GGTGAAGTGTTTAAGAGCTTGGG + Intronic
1079233278 11:18668540-18668562 GGTGTAGTTAATAAGAATGCAGG - Intergenic
1079499075 11:21081978-21082000 GGCGTAGTGTTTCAGAGTATAGG - Intronic
1079607060 11:22383297-22383319 ACTGTAGTGATAAAGAGTTTAGG - Intergenic
1079746944 11:24144760-24144782 GATGTAGTGATGAAAAGTATGGG + Intergenic
1080813739 11:35733264-35733286 GGTGTAATGATTAAGAGACAGGG - Intronic
1080880348 11:36313894-36313916 GGTGTAGTGGTTCAGATTATGGG + Intronic
1080984640 11:37446558-37446580 AGTGTAGTAATTAAGAGCATAGG - Intergenic
1082264023 11:50100297-50100319 GGTGTAGAGATTAGGGCTGTAGG - Intergenic
1082631528 11:55547980-55548002 GTTGTAGTGCTTCAAAGTGTGGG + Intergenic
1085114065 11:73914640-73914662 AGTGTAATGATTAAGAGTTGTGG + Intronic
1085187886 11:74591807-74591829 GGTGTAGTGCGTAAGAGAGTGGG - Intronic
1087758930 11:102085099-102085121 AGAGTAGTGATAAAGAGTTTGGG + Intergenic
1089475773 11:118760514-118760536 GGTGTAGTGTTTAAAAGTACGGG + Intronic
1089801229 11:121030021-121030043 GGTGAAGTGACTATGAGTGATGG + Intronic
1091184241 11:133633425-133633447 AGTGTCGTGATTAAGAACGTGGG - Intergenic
1091512176 12:1138852-1138874 GAATTAGTGGTTAAGAGTGTGGG + Intronic
1091914215 12:4256555-4256577 GGTCTAGTGGTTATGAATGTGGG - Intergenic
1095678128 12:44943748-44943770 AGTTTAGTGATTAAGGTTGTGGG - Intergenic
1097308826 12:58096748-58096770 AGTGCAGTGGTTAAGAATGTGGG + Intergenic
1098185112 12:67888621-67888643 AGTGAAGTGGTTAAGAGTATAGG + Intergenic
1100116653 12:91313714-91313736 TGTTTAGTGGTTAAGAGTGTAGG + Intergenic
1100222183 12:92517139-92517161 GGTGTAGTGAGAATGAGTGAGGG - Intergenic
1100242488 12:92723733-92723755 GGAGTGGTGGTTAAGAATGTGGG - Intronic
1100273086 12:93044872-93044894 AGAGTAGGGATTTAGAGTGTGGG - Intergenic
1100389894 12:94139251-94139273 GGTGTAATGATTAAGAGCTTGGG - Intergenic
1101001276 12:100360706-100360728 AATGTAGTGATTAAGAATGATGG - Intronic
1101016840 12:100510691-100510713 GGCGTAATGGTTAGGAGTGTGGG - Intronic
1101477475 12:105064431-105064453 AGTGTAATGGTTAAGAGTGCAGG - Intronic
1102850042 12:116233795-116233817 GGTGTAGTGATTCAGAGCACGGG - Intronic
1104152168 12:126094263-126094285 AGTACAGTGGTTAAGAGTGTGGG - Intergenic
1104300311 12:127559111-127559133 GGTGAGGAGATGAAGAGTGTAGG + Intergenic
1106294637 13:28400076-28400098 GGTGTAGAGATTAGGAGCATAGG - Intronic
1106404723 13:29463654-29463676 GGTGAAGTGGTCAACAGTGTGGG - Intronic
1107283846 13:38767100-38767122 GGTGCAGTGATTAAGAGCATGGG - Intronic
1108146194 13:47479705-47479727 AGTGTAGTGGTTAAGAGTGTGGG - Intergenic
1109006920 13:56889504-56889526 AGTGTTGTGATTAAGAATTTAGG + Intergenic
1110302808 13:73949160-73949182 AGTATGGTGATTAAGAGTGCTGG - Intronic
1110401687 13:75099185-75099207 AGCCTAGTGATTAAAAGTGTGGG + Intergenic
1110788300 13:79559657-79559679 TGTGTAGTGATAAACAGTTTGGG + Intergenic
1112632154 13:101173367-101173389 AGTTTAGAGGTTAAGAGTGTGGG + Intronic
1112656442 13:101456605-101456627 CATGGAGTGATTAAAAGTGTGGG + Intronic
1112787714 13:102969338-102969360 GGTGCAATGCTTAAGAGTCTAGG + Intergenic
1113719418 13:112542844-112542866 GGTACAGAGCTTAAGAGTGTAGG + Intronic
1116910724 14:50460794-50460816 GGTGTATTAACTAAGAGAGTAGG + Intronic
1117255206 14:53970270-53970292 AGTGCAGTGATTAAGAGGATGGG - Intergenic
1117366209 14:55030856-55030878 GGTATAGTGAAAAACAGTGTAGG + Intronic
1118578683 14:67271324-67271346 GGGATAGTGGTTAAGAGTGATGG + Intronic
1119785453 14:77310234-77310256 GGTGTCATGATTAAGAGAGAAGG + Intronic
1122682477 14:103476326-103476348 GCTCTAATGATGAAGAGTGTTGG + Intronic
1129325956 15:74800398-74800420 GGTGTAGTGCTGCAGGGTGTGGG - Exonic
1129503961 15:76065534-76065556 TCTGAAGTGGTTAAGAGTGTGGG + Intronic
1131638562 15:94264184-94264206 AGTGTAGTGATGAAGAAAGTGGG + Intronic
1132380505 15:101362830-101362852 GGTGCAGTGGTTAAGACTGGGGG - Intronic
1133757759 16:8775515-8775537 AGTGTAGTGGGTAAGAGTATGGG - Intronic
1133807695 16:9138180-9138202 CATGGAGGGATTAAGAGTGTGGG - Intergenic
1134216973 16:12323699-12323721 GGTGGGGTGATTAAGGGTGTGGG + Intronic
1134819133 16:17231380-17231402 GGTGCAGTGGATAACAGTGTTGG + Intronic
1135573227 16:23565417-23565439 GATGTAGTGATCAGGAGTGTGGG + Intronic
1137514032 16:49126948-49126970 AGTGTAGTGATTAAGGGTATAGG + Intergenic
1138472343 16:57247768-57247790 AGTGTAGTGATTAAAATTATGGG - Intronic
1138760747 16:59540770-59540792 GCAGTAGTGAGTAAGAGTGTAGG + Intergenic
1138761046 16:59544732-59544754 GAAGTAGTAAGTAAGAGTGTGGG + Intergenic
1138966390 16:62089316-62089338 GGTGTTGTGATGAAGAGTCCTGG - Intergenic
1139180061 16:64736533-64736555 GGCATAGTGATGGAGAGTGTTGG - Intergenic
1140072878 16:71668103-71668125 AGTGTAGTGATTAAGAGTGAAGG + Intronic
1141213498 16:82002645-82002667 GTTTTAGTGGTTAAGAGTGCGGG - Intronic
1141418218 16:83893742-83893764 GCTGTAGTGATTAAGATGCTAGG + Intergenic
1141626128 16:85262077-85262099 AGTGAAGTGGTTAAGAGTCTGGG - Intergenic
1143971097 17:10796482-10796504 GGTGATGAGATTAAGAGGGTAGG - Intergenic
1146988001 17:37240604-37240626 GGTTTATTGCTTAATAGTGTTGG - Intronic
1147150979 17:38513580-38513602 GGTGGTGTGCTCAAGAGTGTTGG - Intergenic
1148695454 17:49555714-49555736 GATGTAGGGATTAGGGGTGTGGG + Intergenic
1151113675 17:71708017-71708039 GGAGTAGTGATTAAAAGATTTGG - Intergenic
1153456122 18:5283955-5283977 AGTGTAGTGATTTAGAATATGGG - Intergenic
1153896258 18:9564573-9564595 GCTGAAGTGATTAAAAGGGTTGG - Intronic
1155490882 18:26400839-26400861 GGTGTAGGGATCAAGAGTCCAGG - Intergenic
1156022016 18:32610333-32610355 AGTGAAATGATTAAGAGTGTTGG + Intergenic
1156186767 18:34672301-34672323 GGTTTAGTGATTATTTGTGTAGG + Intronic
1156623314 18:38879120-38879142 GGAGTAGGAATAAAGAGTGTGGG - Intergenic
1157450881 18:47787939-47787961 AGCATAGTAATTAAGAGTGTGGG - Intergenic
1158545525 18:58393035-58393057 GGTGTAGTGGTAAAGGGTGCAGG - Intronic
1159188208 18:65006562-65006584 TATGTAATGGTTAAGAGTGTAGG - Intergenic
1159558578 18:69970493-69970515 GGTGTTGAGGTTAAAAGTGTGGG - Intergenic
1159566439 18:70056283-70056305 GGTGCAGTGGTTAAGAATGTGGG + Intronic
1166165139 19:40982414-40982436 GGGGTAGTGATTAAAACAGTAGG + Intergenic
1168272560 19:55258230-55258252 GGTGAAGAGATTAAGAGACTGGG + Intronic
925613653 2:5724907-5724929 GGTGGAGTGATTAAGATTTAAGG + Intergenic
926143089 2:10380243-10380265 GGGGTAGTGAGGAAGTGTGTGGG + Intronic
931550035 2:63433550-63433572 AGTGTAGTAATTAAGAGTCCAGG - Intronic
932683096 2:73843979-73844001 GGTGTAGTGGTTAAAAGAATAGG + Intronic
933150916 2:78913942-78913964 AGTGTAATAATTAAGAGTATGGG + Intergenic
936633104 2:114225989-114226011 AGTGTAGTAATTAGGAGTGGGGG - Intergenic
937328068 2:121004198-121004220 GATGTGGTGATGAGGAGTGTTGG + Intergenic
940212690 2:151272402-151272424 GGTACAATGATTAAGAGTGTAGG + Intronic
941874702 2:170420855-170420877 GGTGTGGTGATGAGGGGTGTCGG - Intronic
942156371 2:173132682-173132704 AGTGTAGTGACTAGGAGTGCAGG + Intronic
942369077 2:175262202-175262224 GGTGCAGTGGTTAAGAGGGTAGG + Intergenic
942544466 2:177048532-177048554 AGTGTAGTGTTTAAAAGTGAGGG + Intergenic
942648448 2:178141344-178141366 AGTGTAGTGGTTAAGAGAATGGG - Intergenic
944726554 2:202477020-202477042 AGTGTAATGATTAAGAGCATAGG + Intronic
945593549 2:211764667-211764689 GTTGTATTGGTTAAGAGTATGGG - Intronic
1168840828 20:909038-909060 TGTGTAGTGGTTAAGACTGTGGG + Intronic
1172148090 20:32771332-32771354 GTTGTAGTGATTAAAAGTAGTGG + Intronic
1172788523 20:37486404-37486426 GGTGAAGGGATTAGCAGTGTTGG + Intergenic
1172791055 20:37505886-37505908 GGTGAAGGGATTAGCAGTGTTGG - Intronic
1173074185 20:39801138-39801160 GGTGTAGTGATCAGTACTGTGGG - Intergenic
1173673308 20:44812611-44812633 GGTGTCATGGTTAAGAGTGCTGG + Intergenic
1173826480 20:46051046-46051068 GGGGTGGTGGTTAAGAGTGTGGG + Intronic
1173874606 20:46362445-46362467 GGTTTAGTGCTTAAGAGTGTGGG + Intronic
1174659099 20:52195051-52195073 GGTTTGGTGGTTAAGTGTGTAGG + Intronic
1174990692 20:55506127-55506149 GGAATAGTGATTAAGAATGTTGG + Intergenic
1180746927 22:18095778-18095800 GGGATTGTGGTTAAGAGTGTGGG + Exonic
1182021377 22:27084389-27084411 GGTGAAGAGGTTAAGAGTATGGG + Intergenic
1182080293 22:27524102-27524124 GGGGTAGGCATTAAGACTGTGGG - Intergenic
1183028480 22:35084299-35084321 GGTGTAGTTATTATGAATTTGGG + Intronic
950332929 3:12170826-12170848 AGAATAGTGATTCAGAGTGTGGG + Intronic
951029690 3:17867674-17867696 GGAGTAATAATTAAAAGTGTGGG - Intronic
951662711 3:25087394-25087416 GGTGTAATGGTTCAGATTGTAGG + Intergenic
951711352 3:25586984-25587006 AGTGTAGCGGTTAAGAGGGTGGG + Intronic
952239450 3:31515379-31515401 AGTGTAATGATTAAGAGTATGGG - Intergenic
955025127 3:55160328-55160350 GGCTCAGTGGTTAAGAGTGTGGG - Intergenic
955509005 3:59660550-59660572 GGTGGAGTAACTAAGAATGTGGG + Intergenic
955702381 3:61694811-61694833 GGTGTTCTGTTTAAGATTGTGGG + Intronic
958120919 3:89286875-89286897 GTTGCAGAGAATAAGAGTGTAGG - Intronic
959783926 3:110270217-110270239 AGTGTAGTGTTTATGAGTATAGG + Intergenic
960223043 3:115138552-115138574 GGGGTGGTGATTAAGAGCTTAGG + Intronic
960233046 3:115251414-115251436 AGCATAGTGATTCAGAGTGTGGG + Intergenic
960391195 3:117079543-117079565 AGCATAGTGGTTAAGAGTGTAGG + Intronic
962843977 3:139259307-139259329 AGTGGAGTGATTTGGAGTGTGGG + Intronic
963505221 3:146176754-146176776 GGCCTAGTGATTAAGAGAGCAGG + Intergenic
966045277 3:175541158-175541180 AGTGAAGGGATTAAGAGTGAAGG - Intronic
966316158 3:178648106-178648128 GGTGCAAAGAATAAGAGTGTTGG - Intronic
967018340 3:185501040-185501062 GGTTTAGTGAGTAAGCATGTAGG + Intergenic
967212941 3:187185016-187185038 TGCGCAGTGATTAAGAGAGTGGG + Intergenic
967462060 3:189759029-189759051 AGTCTAATGATTAAGAGCGTGGG + Intronic
968002996 3:195220447-195220469 GGTGTCGTGGTTAAGAGCATGGG - Intronic
971356058 4:25896239-25896261 GGTATGGTGATTAAGAATTTGGG - Intronic
971387296 4:26152706-26152728 GGATTAGTGATTAAGAGCTTGGG - Intergenic
971475720 4:27069757-27069779 GGAGTACAGATGAAGAGTGTTGG + Intergenic
971769662 4:30880031-30880053 GGTATACTGACTAAGAGTGGGGG - Intronic
973197957 4:47467130-47467152 GGTGTGGTGATTAAGTGTACAGG + Intergenic
973895460 4:55408011-55408033 AGTGTAGTGGTTAAGTGTATAGG - Intronic
974846438 4:67356590-67356612 AGTGTAGAGATTGAGAGTGTGGG - Intergenic
975830658 4:78364870-78364892 GGAGTAGTGGTTAGGAGAGTGGG + Intronic
976114717 4:81714615-81714637 AGTGGAGTGGTTAAGAGGGTAGG + Intronic
977139865 4:93355527-93355549 GGTGTAGTCTTAAAGAGTATTGG - Intronic
979296618 4:119039916-119039938 TTGGTAGTGATTAAGAGTGTGGG + Intronic
979771722 4:124533318-124533340 GGGGTATTGGTTAAGAGTATAGG + Intergenic
980967841 4:139540460-139540482 GATGTAGTGAAAAAGAGGGTTGG + Intronic
981286815 4:143027035-143027057 GCTTTGGTGCTTAAGAGTGTTGG - Intergenic
982787351 4:159551214-159551236 GGTGTAGGAATTGAAAGTGTTGG + Intergenic
984108424 4:175578856-175578878 GGTGTAGTAACTAAGAGGATTGG - Intergenic
984988546 4:185354772-185354794 GGTGTCAAGATTTAGAGTGTTGG - Intronic
986240940 5:5959544-5959566 GGAGTAGTGATTAAGAAACTAGG + Intergenic
988233941 5:28515062-28515084 TGTCTAATGATTAAGGGTGTGGG - Intergenic
988819151 5:34863389-34863411 GGTGTAGTGATGGAGAGAATGGG + Intronic
990238695 5:53795297-53795319 AGTGCAGTGGTTAAGAGTGCAGG + Intergenic
990532066 5:56684086-56684108 GGTGTAGTGGTTAAGCCTGTGGG - Intergenic
990534392 5:56705558-56705580 GGGGTAGTGGATAAGAGTGTGGG - Intergenic
991328257 5:65462595-65462617 GGTGTAGTGGTTAAGAGTTCAGG - Intronic
991692448 5:69237998-69238020 GGAGTAGAAATTATGAGTGTTGG - Intronic
993582060 5:89675139-89675161 CGTATAGTGATTAAGAGTTTGGG + Intergenic
993602661 5:89947585-89947607 GGAGAAGGAATTAAGAGTGTTGG + Intergenic
995064012 5:107840276-107840298 GGTGCAGACATTAAGAGAGTGGG - Intergenic
995786331 5:115833476-115833498 AGTGTGGTGATTAAGTGTATAGG + Intronic
996602244 5:125277754-125277776 ATTATAGTGATTTAGAGTGTAGG + Intergenic
997729590 5:136157857-136157879 TGTCTATTGATTAAGACTGTGGG + Intronic
998528783 5:142866290-142866312 AGTGTAGTAGTTAAGAGTTTTGG + Intronic
998585363 5:143421334-143421356 AACATAGTGATTAAGAGTGTGGG + Intronic
998600502 5:143580303-143580325 GGTATCGTCATTAAGAGTGTGGG - Intergenic
998630757 5:143895938-143895960 GGTACAATGATTAAGAGTTTAGG - Intergenic
998876602 5:146606366-146606388 GGTGTGGTGACTAACAGTATAGG + Intronic
998895497 5:146795049-146795071 AGTGTAGTGATTAAGAAAATGGG + Intronic
999829033 5:155301490-155301512 GGTTTAGAGGTGAAGAGTGTGGG + Intergenic
1000382552 5:160642085-160642107 GGGGCAGTGGATAAGAGTGTGGG + Intronic
1000747876 5:165057449-165057471 AGTTCAGTGATTAAGTGTGTAGG - Intergenic
1001888136 5:175314494-175314516 AGTGTGGTGGTTAAGAGTTTAGG - Intergenic
1004846820 6:19652508-19652530 AGTGTAGTGGTTAGAAGTGTAGG - Intergenic
1004942875 6:20579694-20579716 GGTGCAGTGATTAAGAGCACGGG - Intronic
1005566776 6:27103899-27103921 GCTATAGTAAATAAGAGTGTGGG - Intergenic
1007271848 6:40643774-40643796 GGTGTGGTGGTTAAGAGCATGGG - Intergenic
1010280237 6:74014844-74014866 GGTTCAGTGGTTAAGAGTCTGGG - Intergenic
1011734398 6:90296880-90296902 AATGTAGCGATTGAGAGTGTGGG - Intronic
1011743153 6:90383410-90383432 AGTGTTGTGGTTAAGCGTGTGGG + Intergenic
1012011423 6:93791226-93791248 TGCCTAGTGATTAAGAGGGTAGG - Intergenic
1013159562 6:107528815-107528837 GGTGTAGTGGTCAAGAGCTTGGG + Intronic
1013842560 6:114415077-114415099 GGTGTAGATATTAATAGTTTCGG - Intergenic
1013968312 6:115983294-115983316 TATGTAGGGATTAAGAGTGTGGG - Intronic
1014156328 6:118114215-118114237 GGTATAGTGGTTAAGTGTTTGGG - Intronic
1014551452 6:122793398-122793420 AGTGTCGTGGTTAAGAGTGGAGG - Intronic
1016323226 6:142870822-142870844 GTGGTAGGGGTTAAGAGTGTGGG - Intronic
1016465605 6:144322059-144322081 AGGGTAGTGATTAAGAGTATGGG - Intronic
1016649083 6:146443146-146443168 AGTATGGTGGTTAAGAGTGTGGG - Intergenic
1017715058 6:157204100-157204122 ACTGCAGTGATTAACAGTGTTGG - Intronic
1019807853 7:3141723-3141745 AGTGAAGTGATTAAGAGTCTGGG - Intronic
1019922527 7:4172027-4172049 GGAGTAGTGTCTAAGGGTGTGGG + Intronic
1021308742 7:19064842-19064864 AGAATAGTGATTAACAGTGTGGG + Intronic
1022077256 7:26984306-26984328 GGTGTAGTGGTTAAGAGCATTGG - Intronic
1022186886 7:27978284-27978306 AATGTAGTGGTTAAGAGTATAGG - Intronic
1022681485 7:32551103-32551125 AGTACAGTGCTTAAGAGTGTGGG - Intronic
1022707536 7:32818510-32818532 CCTGTAATTATTAAGAGTGTGGG + Intergenic
1023640483 7:42251816-42251838 TGTGTAGTGGTTAAGAGTGGAGG - Intergenic
1024538110 7:50455022-50455044 GGTGGAGTGATTAAGAGCAGGGG + Intronic
1024790291 7:52958040-52958062 AGTGGAGAGATGAAGAGTGTAGG + Intergenic
1025005074 7:55347465-55347487 GGTGGAGTCATTAAGAGTGTTGG - Intergenic
1027448660 7:78303932-78303954 GGAGTAGGAATTAAGAGTTTTGG - Intronic
1028740359 7:94267656-94267678 GATAAAGTGATTAGGAGTGTGGG + Intergenic
1029049017 7:97663853-97663875 GATGTAGTGATTAAAGGTGTTGG - Intergenic
1029744170 7:102507605-102507627 GGTGCTGCGATTATGAGTGTGGG + Intronic
1030646580 7:112067950-112067972 AGTGTAGTGATTAATGGTCTGGG - Intronic
1030734699 7:113033526-113033548 GGTGGGGTGATGGAGAGTGTTGG + Intergenic
1030916661 7:115322915-115322937 AGTGTAGTGATTAAAAGTGAAGG + Intergenic
1031814236 7:126412777-126412799 TGGGAAGTGATTAAGAGAGTGGG + Intergenic
1032658948 7:133962035-133962057 GGTGTTGAGATTAAGTGCGTGGG - Intronic
1033178588 7:139151461-139151483 AGGGTAGTGATTATGAGTTTGGG + Intronic
1033440366 7:141372963-141372985 GGCTTAGTGATTAAGAGTATTGG + Intronic
1033465419 7:141584668-141584690 GGTGTAGTTTTTACTAGTGTAGG + Intronic
1035248853 7:157583406-157583428 ACTGTAGTTAATAAGAGTGTTGG + Intronic
1036742081 8:11372186-11372208 GGTGGTGTGATCAAGAGAGTGGG - Intergenic
1038433283 8:27516586-27516608 GCTGTATTCATTCAGAGTGTGGG - Intronic
1042388724 8:68207815-68207837 GGTGTAGGGATTAAGAACATGGG - Intronic
1043518218 8:81016373-81016395 AGTGAAGTGACTAAGAGTGTAGG - Intronic
1044154947 8:88833909-88833931 GTTTTTGTCATTAAGAGTGTTGG - Intergenic
1044528069 8:93274915-93274937 GGTGTAGGGAATAACAGTTTGGG + Intergenic
1045133362 8:99183633-99183655 ATTGTAGTGTTTCAGAGTGTTGG + Intronic
1046273348 8:111924953-111924975 GGTGTAGTAGTTAAGAGTGCTGG - Intergenic
1047162446 8:122395765-122395787 GGCGTGATGGTTAAGAGTGTGGG + Intergenic
1047552074 8:125885030-125885052 GATGTAGTGGTTAAGAGCATGGG - Intergenic
1047817703 8:128483019-128483041 GGTGATGTGATAAAGAGTGATGG + Intergenic
1048505600 8:135018203-135018225 AGTGTAGACATTCAGAGTGTTGG + Intergenic
1052481241 9:29029192-29029214 GGTGCAGGGATTAAGGTTGTGGG + Intergenic
1053297080 9:36922827-36922849 TGTGTAGAGATTGGGAGTGTGGG - Intronic
1055183422 9:73419179-73419201 GGTTTTCTGATTGAGAGTGTAGG - Intergenic
1058057851 9:100467256-100467278 AGCATAGTAATTAAGAGTGTAGG - Intronic
1058274482 9:103023325-103023347 GATGTAGTGATTAAGAGCATGGG - Intergenic
1058428637 9:104898671-104898693 GGTGGAGTGAATAAGACTGGCGG - Intronic
1058731209 9:107851564-107851586 GGTATAGTGGTTAAGAGAGTGGG + Intergenic
1058850393 9:109006439-109006461 GGTGTAGTGATTAAGAGTGTAGG - Intronic
1060564200 9:124575231-124575253 TATATAGTGATTAAGAGCGTGGG + Intronic
1061147145 9:128806636-128806658 GGTGTAGTGATTAAGAACATGGG + Intronic
1061696517 9:132379662-132379684 AGTGTAATGGTTAAGAGGGTAGG - Intronic
1187037053 X:15551288-15551310 GGTGTAATGGTTAAGCCTGTGGG + Intronic
1189368748 X:40411043-40411065 GGTGTAGTGGTTAAAAGCATGGG - Intergenic
1190736365 X:53257954-53257976 GGCTTAATGTTTAAGAGTGTGGG - Intronic
1190877314 X:54469140-54469162 AGTGTAGTGGTTAAGCATGTGGG + Intronic
1192194640 X:69020084-69020106 AGTGTAGTGATTAAGAGCACAGG - Intergenic
1192212128 X:69134339-69134361 GGTGGAGTGGTTGAGAGTGTGGG + Intergenic
1193094904 X:77536909-77536931 GGTGTAGTGATTAAGATCACAGG + Intronic
1194768390 X:97870344-97870366 GGTGTAGTGAGAAAGATTTTAGG - Intergenic
1195177303 X:102323266-102323288 AGCCTAGTGTTTAAGAGTGTGGG + Intronic
1195181561 X:102363827-102363849 AGCCTAGTGTTTAAGAGTGTGGG - Intronic
1195205500 X:102595705-102595727 GGTGCAGTGGTTAAGAGTACTGG + Intergenic
1195694694 X:107658296-107658318 AATGTAGTGGTTAAGAGTATGGG + Intergenic
1196757890 X:119173859-119173881 GGTGCAGTGATTAAGAGCATGGG - Intergenic
1197286709 X:124603592-124603614 AGTGTAGTGGTTAAAAGTGTGGG - Intronic
1198154618 X:133946606-133946628 AGTGTAATGATTAAGAGTGCAGG - Intronic
1198478629 X:137019765-137019787 GGTATAGTGATTAAGACCATGGG - Intergenic
1198897096 X:141467565-141467587 GTTGTAGGGATTAAGTGAGTTGG + Intergenic