ID: 1058850395

View in Genome Browser
Species Human (GRCh38)
Location 9:109006460-109006482
Sequence ATCCTGGAAGGTAAGAGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 375}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058850395_1058850399 -6 Left 1058850395 9:109006460-109006482 CCGTCTCTCTTACCTTCCAGGAT 0: 1
1: 0
2: 2
3: 40
4: 375
Right 1058850399 9:109006477-109006499 CAGGATTATGTTAAGGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058850395 Original CRISPR ATCCTGGAAGGTAAGAGAGA CGG (reversed) Intronic
901197208 1:7446946-7446968 TACCTGGGAGGTAAGAAAGACGG - Intronic
901291351 1:8126693-8126715 GTCCTGGTGGGTAAGACAGACGG - Intergenic
901315316 1:8303458-8303480 GTCATGGAAGGGAACAGAGATGG + Intergenic
901395020 1:8974875-8974897 ATCCTGGACAGGAAGTGAGATGG + Intronic
901715346 1:11149250-11149272 ATCCTGGAAGGGGAGAAGGAGGG - Intronic
901860243 1:12069822-12069844 ATCCTGTAGTGTGAGAGAGACGG + Intronic
902343586 1:15800078-15800100 GTCTTGGAAGATAAGAGAGGCGG - Intergenic
902620193 1:17646309-17646331 ATCCTGCCGGGTCAGAGAGAAGG - Intronic
902885231 1:19400107-19400129 CTCCTGGAAGAGAAAAGAGAAGG - Intronic
902926400 1:19698569-19698591 AACATGGAGGGTAAGAGGGATGG - Intronic
902963528 1:19981263-19981285 ACACTGGAAGCTAGGAGAGAGGG + Intergenic
903753487 1:25644896-25644918 AACCTGGATGGAAAGGGAGAGGG + Intronic
904051225 1:27640204-27640226 AAGCTGGATGGTACGAGAGATGG - Intergenic
905177311 1:36145447-36145469 AGGCTGGAGGGTAAGAGAGTTGG - Intronic
905312142 1:37056687-37056709 AGCCTGGAAGCTACCAGAGAAGG + Intergenic
905338884 1:37264723-37264745 ATCTTGGAAGCTAAGAGTTAGGG - Intergenic
905389601 1:37627861-37627883 ATCCTTGATGGTAAGAGGCAAGG - Intronic
905959136 1:42028815-42028837 ATCCTGACAGGTAAGATAAATGG + Intronic
906824920 1:48969104-48969126 ATGCTGGAAGAAAAGAGGGAGGG - Intronic
907164966 1:52402453-52402475 TTCCTGGATGGAAAGAGATACGG - Intronic
907554017 1:55329081-55329103 ACCCTGGAAGGAAAAAGAAAAGG + Intergenic
907839194 1:58140140-58140162 GACCTGGAAGATAAGAGGGATGG - Intronic
908088627 1:60663023-60663045 TTCCTGGAAAATAAGGGAGAGGG + Intergenic
909023197 1:70454770-70454792 ATTCTGGAGGCTGAGAGAGAAGG - Intergenic
909488572 1:76201296-76201318 ATGGTGGCAGGCAAGAGAGAGGG + Intronic
910423132 1:87090763-87090785 ACCATGGAAGATAAGAGAGGTGG - Intronic
910441485 1:87257212-87257234 AGTTTGGAAGGAAAGAGAGAAGG - Intergenic
911146297 1:94555480-94555502 AGCCTGGAGGGCAAGAGAAAGGG + Intergenic
911717148 1:101146255-101146277 GTCTAGGAAGGTAAGAGACAGGG - Intergenic
911720522 1:101186520-101186542 ATGGTGGCAGGTGAGAGAGATGG - Intergenic
914444507 1:147738675-147738697 ACCCTGAAAGGTAAGAAATATGG - Intergenic
915509698 1:156379854-156379876 ATCCTGGAGGGAGAGACAGAAGG - Intronic
917401759 1:174657396-174657418 AGCTTGGAAGGGTAGAGAGAAGG - Intronic
918152957 1:181814330-181814352 CACCTGGAAGGTAAGAGGAATGG - Intergenic
918279589 1:182990823-182990845 AGACTGGAAGGTAGGAGAAAGGG + Intergenic
919545440 1:198911891-198911913 ATGGTGGCAGGCAAGAGAGAAGG + Intergenic
920736137 1:208534462-208534484 AGCCTGGGAGGTAAAAGAGAAGG - Intergenic
920751721 1:208684427-208684449 CTCCTGGAAGGAAGGAGAGCTGG + Intergenic
923062931 1:230492818-230492840 AGCCTAGAAGGACAGAGAGAAGG + Intergenic
923148802 1:231216215-231216237 ATGGAGGAAAGTAAGAGAGAAGG - Exonic
1063066831 10:2618656-2618678 CTTCTGGAAGCTCAGAGAGAGGG - Intergenic
1063666199 10:8062084-8062106 AGGCTGGAAGGAAAGAGTGAAGG - Intronic
1065885357 10:30072098-30072120 ATTCTGGAAGGAAGGAAAGAAGG + Intronic
1066250101 10:33624901-33624923 ATGGTGGGAAGTAAGAGAGAGGG + Intergenic
1066569762 10:36758241-36758263 AGCCTGGAAGGAGAGAGAGGGGG - Intergenic
1067143977 10:43680197-43680219 ATGGTGGAAGGTAAGAGGGCAGG - Intergenic
1067552830 10:47247280-47247302 GTCCTGGAAGGTCAGGGATAGGG + Intergenic
1070669602 10:78368742-78368764 TTCCTGGAAGGCAAGAGACCTGG + Intergenic
1070785432 10:79159711-79159733 ACCCTGCTAGGAAAGAGAGAAGG - Intronic
1071365521 10:84896457-84896479 ATCCAGGAAAGGAAGAGTGAAGG - Intergenic
1071385349 10:85114025-85114047 ATTGTGGAAGGTGAGAGAGAGGG - Intergenic
1073027641 10:100499736-100499758 ATCCAGGGAGGAAAAAGAGATGG - Intronic
1073768323 10:106707688-106707710 ATCCTGGTGGGTGTGAGAGAGGG + Intronic
1074052040 10:109888754-109888776 ATCCTGGAAGGCTACAGAGAGGG + Intronic
1074206967 10:111291163-111291185 AACCTGCAAGGTAAGGGAAAAGG - Intergenic
1075157635 10:119991277-119991299 TTGCTGGAAGGTGAAAGAGAGGG + Intergenic
1075235428 10:120723278-120723300 ATTCTGGAAGGAAAGAATGAAGG + Intergenic
1075594717 10:123720651-123720673 GTCAGGGAAGGTAAGAGAGGTGG - Intronic
1077259172 11:1606564-1606586 ATCCTGGAAGATGGGAAAGACGG + Intergenic
1077355830 11:2116469-2116491 GTGATGGAAGGTAAGAGAGATGG + Intergenic
1078076035 11:8161679-8161701 AGGCTGGAAGGTGAGAGTGATGG + Intronic
1078198446 11:9156792-9156814 ACTCTCGAAGGAAAGAGAGAAGG + Intronic
1078540228 11:12207154-12207176 GTCCTGGAAGCCAAGAGAGGAGG - Intronic
1078900482 11:15637927-15637949 ATGATGGAAGGAAAGAAAGAAGG - Intergenic
1080930374 11:36803902-36803924 ATCCTGGAAGCTTTGAGAAAAGG + Intergenic
1083528187 11:63391884-63391906 ATACAGGAAGGAAGGAGAGAAGG - Intronic
1083741786 11:64715073-64715095 CGCCTGGAAAGTAACAGAGATGG + Intronic
1084353086 11:68617791-68617813 CTCCTGGCAGGGAAGAGAGAAGG + Intergenic
1084682896 11:70677459-70677481 GTCATGGAAGGTCAGAGGGAAGG - Intronic
1084800383 11:71539702-71539724 ATCCTGGAAGATGGGAAAGATGG - Intronic
1085789282 11:79482938-79482960 ATGCTGGAAAGGAAGTGAGAAGG + Intergenic
1085855806 11:80174252-80174274 ATACTGGCAGGTAAGAGATTAGG + Intergenic
1085892734 11:80600232-80600254 ATCCTTGAAGGTCAGAAAAATGG + Intergenic
1086428164 11:86707585-86707607 ATCCTGGAAGGAAGGAGCCATGG + Intergenic
1087503176 11:98985731-98985753 ATACAGGAAGGTAAGAAAGAAGG + Intergenic
1087558224 11:99749801-99749823 TTCCTGGAAGGTAAGATTGGTGG + Intronic
1087618992 11:100521094-100521116 ATCCTGGAAGTTGAGTGTGAGGG - Intergenic
1089856604 11:121550661-121550683 CCCCTGGCAGGTAAGAGAGGTGG + Exonic
1092078344 12:5691947-5691969 AGCATGGAAGGGAAGAAAGATGG + Intronic
1093018941 12:14185449-14185471 AATGTGGAAGGGAAGAGAGAAGG + Intergenic
1093598675 12:20994675-20994697 ACCCCGGAAGGTCAGAAAGAGGG + Intergenic
1095731405 12:45510648-45510670 ATGATGGTAGGCAAGAGAGAGGG + Intergenic
1096920309 12:55077493-55077515 ATTATGAAAGGTTAGAGAGATGG + Intergenic
1097037026 12:56130771-56130793 AATCTGGGAGGAAAGAGAGATGG - Exonic
1099426452 12:82529809-82529831 ATTCTGGAAGGCAGGAGAGATGG - Intergenic
1100178338 12:92056519-92056541 ACCCTGGAAGGGCAGAGACAGGG - Intronic
1100755837 12:97750141-97750163 ATCCTCAAACGTAAAAGAGAGGG - Intergenic
1102231018 12:111262306-111262328 ATGCTGGAAGGTGAGAGACCAGG + Intronic
1103001779 12:117390297-117390319 AGCCAGGAAGGAAAGGGAGAAGG - Intronic
1103663257 12:122539279-122539301 ATCCTGGCAGGCAAGAGACATGG - Intronic
1104334335 12:127879387-127879409 ATGCAGGGAGGTAAGAGAGGTGG + Intergenic
1104819282 12:131665619-131665641 ACCCTGGAAGGCAAGAAATAGGG + Intergenic
1105284821 13:18995274-18995296 ATCCAGAAAGCCAAGAGAGAAGG + Intergenic
1105565120 13:21537960-21537982 ATCCTGGAAAATAGGAAAGAAGG - Intronic
1105699873 13:22927549-22927571 ATGCTGGATGGTCAGAGACATGG - Intergenic
1106155742 13:27154150-27154172 ATCTTGGAGGTTTAGAGAGAAGG - Intronic
1106563592 13:30867170-30867192 TTCCTAGAAGGTAAGCAAGAAGG + Intergenic
1108678552 13:52759813-52759835 AAGCAGGAAGGGAAGAGAGATGG + Intergenic
1109374204 13:61468638-61468660 ATGCTGTTAGGTAAGAGAGGGGG + Intergenic
1109645427 13:65248107-65248129 ATACTTGAAGGTGAGAAAGATGG + Intergenic
1110514745 13:76396755-76396777 CCCTTGGAAGGTTAGAGAGAGGG - Intergenic
1111529394 13:89517572-89517594 ATGATGGAAGGAAAGAGAGGGGG + Intergenic
1114195719 14:20474566-20474588 ACTCTGGAAGGTAAGTCAGAGGG + Exonic
1114629377 14:24149386-24149408 AGCCTGGAGGGCAGGAGAGATGG - Exonic
1115657017 14:35453052-35453074 ATCCTGGAAGCTAAGATATGAGG - Intergenic
1115662786 14:35513093-35513115 ATCCAGGGAGGAAAGCGAGAGGG + Intergenic
1115870346 14:37793807-37793829 ATCATAGAATGTAACAGAGATGG + Intronic
1116111555 14:40591766-40591788 AGACTGGAAGCTGAGAGAGAGGG - Intergenic
1116122135 14:40734493-40734515 CTCTTGGCATGTAAGAGAGAAGG - Intergenic
1116759960 14:48999755-48999777 TTCCTGGAATGTGAGAGTGATGG + Intergenic
1116974391 14:51099547-51099569 ATGGTGGAAGGGCAGAGAGAGGG + Intergenic
1117963630 14:61186093-61186115 CTCCTGGAAAGTAAGGGAGAGGG - Intergenic
1119058290 14:71446866-71446888 ATCCTGCAAATAAAGAGAGATGG + Intronic
1119075669 14:71635309-71635331 ATCTTGGAACTTCAGAGAGAAGG + Intronic
1119479003 14:74948246-74948268 ATACTGCAAGGGAAGAGAGAGGG - Intronic
1119929639 14:78532519-78532541 CTCCTGAAAGATAGGAGAGAAGG - Intronic
1120058310 14:79951540-79951562 TTCCAGGAAGCTAAGACAGATGG + Intergenic
1120068499 14:80074927-80074949 AACCTGGAAGGTAATACACAGGG - Intergenic
1120999283 14:90439943-90439965 ATTCTGGAAGACAAGTGAGAAGG + Intergenic
1122226207 14:100281625-100281647 GTCCTGTAAAGTCAGAGAGAAGG - Exonic
1122227340 14:100287372-100287394 AGCGTGGAAGGGCAGAGAGAAGG - Intergenic
1124201168 15:27679626-27679648 ACCCTGAGAGGTAAGACAGATGG + Intergenic
1125028447 15:35053351-35053373 TTACTGGAAGGGGAGAGAGACGG - Intergenic
1125289197 15:38127124-38127146 AACCTGGGAGGTAAGTGGGAAGG + Intergenic
1125859371 15:42983991-42984013 ATGCTAGATTGTAAGAGAGAAGG + Exonic
1125969381 15:43899650-43899672 CTCCTGGAAGGAAAGAGGGAGGG - Intronic
1126166567 15:45658887-45658909 AGGCTGGAAGGGAAGAGACAGGG - Exonic
1126276413 15:46887746-46887768 ATTCTGAAAGGTAAGAGAGTTGG + Intergenic
1128330320 15:66751414-66751436 AGCCTGGAAGGGAAGGGAGTGGG - Intronic
1128380085 15:67106001-67106023 GTCCTGGATGGTGAGGGAGAAGG - Intronic
1129376700 15:75138236-75138258 ACTCAGGAAGGTTAGAGAGAGGG - Intergenic
1130148082 15:81290531-81290553 AGTCTGGAAGGTAAGACAAATGG + Exonic
1131298343 15:91172339-91172361 GACCTTGAAGGGAAGAGAGAGGG - Intronic
1132568113 16:632383-632405 ATTCTGGAAGGTAAGCCAGGTGG + Intronic
1133669787 16:8007128-8007150 ATCCTGGTGGGTGAGACAGAAGG - Intergenic
1133712971 16:8419400-8419422 ATCTTGGAATGGAAGAGGGAAGG - Intergenic
1134111358 16:11517311-11517333 ATCGTGGAATGAAAGAGTGAAGG - Intronic
1134305493 16:13028466-13028488 ATGGTGGCAGGCAAGAGAGAAGG + Intronic
1135927649 16:26709732-26709754 ATCAGGGAAGGAAAGAGGGAAGG + Intergenic
1135974135 16:27096195-27096217 CTGGTGGAAGGTAAGAGAGGAGG + Intergenic
1137561396 16:49504610-49504632 ATCTTAGAAGGTAAGAGAAAGGG + Intronic
1137683594 16:50371115-50371137 AGCCAAGAAGGCAAGAGAGACGG - Intergenic
1138207785 16:55137516-55137538 ATGGTGGCAGGTGAGAGAGAGGG + Intergenic
1138587741 16:57982116-57982138 GTCCAAGAATGTAAGAGAGAGGG - Intronic
1141397872 16:83720792-83720814 ATCCTGGAAGGTAAGCCCCATGG + Intronic
1143124884 17:4635722-4635744 ATAGTGGCAGGCAAGAGAGAAGG + Intronic
1143157940 17:4850568-4850590 ATCCTGGAAGGAGAGGGAGAGGG - Intronic
1143590609 17:7884515-7884537 CTCTTGGGAGGAAAGAGAGAAGG + Intronic
1143633735 17:8152653-8152675 ATAATGGAAGGGAGGAGAGAGGG + Intronic
1144739139 17:17571515-17571537 AGCCTGGGAGGGAAGAGGGAAGG + Intronic
1145879286 17:28341975-28341997 ACCCTGGAAGGAAGGAGACAAGG - Intronic
1146620604 17:34394191-34394213 ATTCAGGAAGGTTGGAGAGAGGG + Intergenic
1146906940 17:36623960-36623982 ATCCTGGGAGGGGAGAGGGACGG - Intergenic
1147161336 17:38571119-38571141 ATCCTGGAAAGAGACAGAGAAGG - Intronic
1147957420 17:44143903-44143925 ATCCTGGAAGGGAAGAAAGGGGG - Intronic
1148087073 17:45000730-45000752 ATCCTGGAGCCTCAGAGAGAAGG + Intergenic
1148317387 17:46714605-46714627 TTGCTTGAATGTAAGAGAGATGG - Intronic
1148556272 17:48580698-48580720 ATCCTGGGAGCCAGGAGAGAGGG + Intronic
1149036236 17:52137204-52137226 ATACTGCTAGGTAAGAGAGCTGG - Intronic
1149682978 17:58518409-58518431 AACCTGCAGGCTAAGAGAGAAGG + Intergenic
1150705852 17:67486767-67486789 ACCCTGAAAGGCAAGAGAGGAGG - Intronic
1152418090 17:80175889-80175911 TTCCTGGCAGGGATGAGAGAGGG + Intronic
1153520752 18:5951492-5951514 ATCGAGGCAGGTCAGAGAGAAGG - Intergenic
1154425458 18:14268702-14268724 CTGCTGGAAGGTAAAAGGGATGG + Intergenic
1154433152 18:14323945-14323967 CTGCTGGAAGGTAAAAGGGATGG + Intergenic
1156404803 18:36773635-36773657 AGCCTGGAAGGGAAGAAAGGTGG - Intronic
1156514788 18:37670523-37670545 AGCCAGGCAGGTAAGAGAAACGG + Intergenic
1157762975 18:50277761-50277783 ACCTTGGAAGATAAGAGATAGGG + Intronic
1159775141 18:72596105-72596127 AGACTGGAAGGAAAGAAAGAAGG - Intronic
1160036283 18:75304601-75304623 ACCCAGGAAGGGAGGAGAGAGGG + Intergenic
1160434267 18:78833309-78833331 AGCCAGGAAGGTGAGAGGGACGG + Intergenic
1161045556 19:2132576-2132598 GTCCTGGAAAGTGAGAGAAAGGG + Exonic
1161139573 19:2639664-2639686 ATTCAGGAAGGAAGGAGAGAGGG + Intronic
1164708319 19:30336607-30336629 TGCCTGGAAGGTAGGTGAGATGG + Intronic
1165769501 19:38370691-38370713 ATCCTGGAATGTCTCAGAGACGG - Exonic
1168097875 19:54125779-54125801 ATCCTGGGAGGAGAGAGAGTGGG + Intronic
925119277 2:1404863-1404885 ATCTTGAAAGGTAAGAAAAAAGG - Intronic
925616281 2:5747258-5747280 ATCCTGGCAGGGAAGAGAGATGG - Intergenic
927593623 2:24378092-24378114 GACCTGGAAGGAATGAGAGAAGG - Intergenic
927942368 2:27113022-27113044 TTCCAGGAAGGTTAGAGAGAAGG + Intronic
928057251 2:28069982-28070004 ATTCTGGAAGCTAAGATGGAAGG - Intronic
928136800 2:28693865-28693887 ATACAGGAAGGAAAGAGGGAAGG - Intergenic
928836615 2:35555250-35555272 GTCCTGGCAGATAAGAGACAAGG + Intergenic
928950052 2:36806392-36806414 ATCCTGGAAGTCCAGGGAGAAGG - Intronic
930531333 2:52592120-52592142 CTTCTGGAAGCTAAGAAAGAGGG - Intergenic
930876742 2:56227428-56227450 AGCCTGGAGGGGAAGAGAAATGG + Intronic
931196252 2:60054642-60054664 GGCATGGAAGCTAAGAGAGAAGG + Intergenic
931711892 2:64995107-64995129 CTCCTGGGAGGTAAAAGAAATGG - Intronic
931802679 2:65773856-65773878 CTACAGGAAGGCAAGAGAGAAGG - Intergenic
932178692 2:69626020-69626042 GACCTGGAAGGAAGGAGAGAAGG - Intronic
932901735 2:75709275-75709297 ATTCTAGAAGGCAAGAGAAAAGG + Intronic
933207933 2:79530786-79530808 ATGCTGAAAGGGAAGTGAGAGGG + Intronic
933245877 2:79974350-79974372 ATCCTAAAAGGTTAGCGAGAAGG + Intronic
933751879 2:85607932-85607954 CTCCTGGGAGGTAGGAGAGAAGG + Exonic
934055384 2:88247175-88247197 ATCAAGGAAGGAAAGAGGGAAGG + Intergenic
934528986 2:95073498-95073520 TTCCTGGAAGGTCTCAGAGATGG + Intergenic
937847920 2:126601715-126601737 GTCCTTGAAGGTGAGACAGAGGG - Intergenic
938738060 2:134204509-134204531 GTCATGGAAGGTAAGAGAGCTGG + Intronic
939903499 2:147880552-147880574 ATCCTGCAAGGTAAGACAGAAGG - Intronic
940622267 2:156126936-156126958 ATGGTGGAAGGTAAAGGAGAAGG + Intergenic
942350799 2:175050874-175050896 AAACTGGAAGGTAAGAGAAGTGG + Intergenic
943669432 2:190646265-190646287 ATCCTGGAAGGTAACAATTATGG - Intergenic
943714286 2:191133421-191133443 ATAATGTAAGGTAAGAGATATGG + Intronic
944828745 2:203511639-203511661 ACCCTGGAAGGGAAGAGGAAGGG - Intronic
946152159 2:217783277-217783299 ATCCCAGAAGATGAGAGAGAGGG - Intergenic
946883676 2:224201664-224201686 ATCCTGGAAGACATGTGAGATGG + Intergenic
947858084 2:233338101-233338123 ATCTTGGAAGGCAGGAGAGAAGG + Intronic
1169027492 20:2383070-2383092 GACCAGGAAGGAAAGAGAGATGG + Intronic
1169087518 20:2836497-2836519 AGTCTGAGAGGTAAGAGAGAAGG - Intronic
1169315479 20:4587207-4587229 ATGCTGGAAGGTCTGAGACACGG - Intergenic
1170525055 20:17228358-17228380 ATCCTGGGAGGACAGAGAGAAGG + Intronic
1170724850 20:18917242-18917264 AGCCTTGAGGGGAAGAGAGAAGG - Intergenic
1170767590 20:19303990-19304012 ATCCTCGAAGCTAGGAGATAAGG - Intronic
1170972055 20:21125782-21125804 ATCCTGGAAGGTGAGGGGAAAGG + Intergenic
1171749259 20:29031917-29031939 CTCCTGGCAGGTAAGAAAGAAGG + Intergenic
1172129325 20:32645344-32645366 ATTCTGGAAGGTCAGTGAGCCGG - Intergenic
1172185904 20:33030986-33031008 ATCTTGGTAAGTAAGAGGGAAGG + Intergenic
1174550201 20:51356540-51356562 AACCAGGAAGGTAAGTCAGAAGG - Intergenic
1174587311 20:51619041-51619063 CACCTGGAAGGGAACAGAGATGG + Exonic
1174676738 20:52364892-52364914 ATGATGGAAGGAAAGAGATAAGG - Intergenic
1174890777 20:54389583-54389605 AGCCTGGTTGGGAAGAGAGAGGG + Intergenic
1175051998 20:56164284-56164306 ATCCTGTGTGGCAAGAGAGAAGG - Intergenic
1175278785 20:57788813-57788835 ACCCTGGAAGGAAGGACAGAAGG + Intergenic
1176702777 21:10077182-10077204 TTTCTGGATGGAAAGAGAGATGG + Intergenic
1176959451 21:15142879-15142901 ATCCTGAATGGCAAGATAGAAGG + Intergenic
1180077579 21:45470857-45470879 ACCTTGGAAGGTCAGAGAGCTGG + Intronic
1180151927 21:45952970-45952992 AGATTGGAAGGGAAGAGAGACGG - Intergenic
1180912627 22:19462816-19462838 ATCCTAGAAGGAAAGCAAGAAGG - Intronic
1181264871 22:21625125-21625147 ATCCAGGAAGCAGAGAGAGAAGG - Intergenic
1182678822 22:32062313-32062335 ATCCTGGAAGGTTGGTGGGAGGG - Intronic
1182763319 22:32740478-32740500 ATCAGAGAAGGGAAGAGAGATGG + Intronic
1182773859 22:32816614-32816636 ATCCTGCCAGGTTAGAAAGATGG + Intronic
1183937131 22:41269301-41269323 GGCCTGGAAGGTTAGAGGGAGGG + Intronic
1184318613 22:43720606-43720628 ATCATGGAAGGAAACAAAGAAGG + Intronic
1184738195 22:46411421-46411443 ATTCTAGAAGGTCAGAGGGAAGG + Intronic
1185153039 22:49177388-49177410 ATCATTGAATGTAAAAGAGATGG + Intergenic
949156776 3:837351-837373 ATGGTGGAAGGTGAGAGGGAAGG + Intergenic
949298506 3:2555624-2555646 ATCACAGAAGGGAAGAGAGAGGG + Intronic
949399270 3:3648599-3648621 ATCCCTCAAGGTAAGTGAGAGGG - Intergenic
950399343 3:12758704-12758726 CTCCAGGAAGGGCAGAGAGAGGG + Intronic
951181655 3:19666032-19666054 TTCCTGGAAGGGCAGAGAGGGGG - Intergenic
953231771 3:41071730-41071752 TTCCTGAAAGGCAAGAGGGATGG - Intergenic
954034376 3:47843082-47843104 TACATGGAAGGCAAGAGAGATGG - Intronic
954711191 3:52505863-52505885 ACCCTGGCAGGGGAGAGAGAGGG - Exonic
954862516 3:53702644-53702666 ATTCTCAAAGGAAAGAGAGAAGG + Exonic
956790800 3:72678620-72678642 ATAAAGGAAGGAAAGAGAGAAGG + Intergenic
957781912 3:84829551-84829573 ATGGTGGAAGGTAAGAGAACAGG + Intergenic
957794369 3:84984410-84984432 AACATGGGAGGTAAGGGAGATGG - Intronic
958828034 3:99055813-99055835 TTCCTAGAGGGTAAGAAAGAAGG + Intergenic
960148576 3:114229293-114229315 AATATGGAAGGTAAGAGAAAGGG + Intergenic
960634428 3:119768913-119768935 AGCATGGAAGTTAAGAGAGCAGG + Intergenic
960957253 3:123041843-123041865 AACCTAGAAGGCAAGAGAGGTGG + Intergenic
961667196 3:128499835-128499857 ATATTGGAAGGTTACAGAGAAGG - Intergenic
961798600 3:129427507-129427529 ATGCTGGGAGGTGAGGGAGAAGG - Intronic
962411539 3:135145380-135145402 ATCCTAGAAGCTATGAGTGATGG - Intronic
962872515 3:139509932-139509954 CTCCTGGAAGGGAAGATGGAGGG - Intergenic
963255330 3:143139260-143139282 ACCCAGGCAGGTAATAGAGAAGG - Intergenic
963889064 3:150613226-150613248 ATGGTGGAAGGTCAAAGAGAGGG + Intronic
963956625 3:151261392-151261414 ATTGTGGAGGGTAAGAGGGATGG + Intronic
964044485 3:152306673-152306695 AGTCTGGTAGGTAAGACAGAAGG + Intronic
965794715 3:172427920-172427942 AGCCTAGAGGGCAAGAGAGAGGG - Intergenic
966425584 3:179776381-179776403 AACTTGGAAGGTAAAAGAGGTGG - Intronic
967526928 3:190506014-190506036 ATCAAGGAAAGAAAGAGAGAGGG - Intergenic
968229907 3:196999439-196999461 AGCCTGGATGGGAAGAGAGCGGG - Intronic
970943804 4:21666452-21666474 ATCCTGATATGTAAGAGAGTAGG - Intronic
971512861 4:27448447-27448469 AATCTAGAAGGCAAGAGAGATGG - Intergenic
971580654 4:28335127-28335149 ATGGTGGCAGGTGAGAGAGAAGG - Intergenic
971668319 4:29522789-29522811 ATGGTGGAAGGTAACAGAGAAGG + Intergenic
971993720 4:33935639-33935661 ATGATGGAAGGTAGAAGAGAAGG - Intergenic
973994139 4:56439554-56439576 ATCATGGAGGATAAAAGAGAGGG - Intronic
974305658 4:60135672-60135694 ATACTGGAAGGCAAGAGTGGTGG + Intergenic
977664430 4:99629250-99629272 ATCCAGGAAGGTAGGAGGCAGGG + Intergenic
978165104 4:105597495-105597517 ATTCTGGAAGTGAACAGAGATGG - Intronic
980374965 4:131933560-131933582 TTTCTGGATGGCAAGAGAGATGG + Intergenic
980660729 4:135855045-135855067 ATCCTGAAAGGAAAGACATAGGG - Intergenic
980670260 4:135995509-135995531 GTCCTGGAATGAGAGAGAGATGG - Intergenic
981662282 4:147182319-147182341 GTCTTGGAAGCTAAGAGAGGGGG - Intergenic
981922008 4:150096111-150096133 ATCCGGGAAGAAACGAGAGAAGG + Intronic
982024986 4:151243479-151243501 ATCCTGACATGTAAGAGACAGGG - Intronic
982865049 4:160499898-160499920 AGCCTGGCAGGCAAGAGAGTAGG - Intergenic
982983028 4:162165004-162165026 CTCCTTGAAGGCAAGAGAAAGGG + Intergenic
983932127 4:173463801-173463823 ATCCTGGAAGGTTGGGGAGAAGG + Intergenic
984451969 4:179913923-179913945 ACATTTGAAGGTAAGAGAGAAGG - Intergenic
984695707 4:182777203-182777225 ATAATGCAAGGTAAGAGAGGTGG - Intronic
986023889 5:3831627-3831649 ATGATGGAAGGTGAAAGAGAGGG - Intergenic
986181044 5:5393197-5393219 GTCCTGGAAGGTGGGAGAAATGG - Intergenic
986572030 5:9175580-9175602 ATTCTGGAATGTAGAAGAGAAGG - Intronic
987707082 5:21471323-21471345 GTCCTGGAAGGTGGGAGAAATGG + Intergenic
987897662 5:23968970-23968992 ATGTCAGAAGGTAAGAGAGATGG - Intronic
989073997 5:37543064-37543086 ATCCTGGAGGGTGAAAGAGTTGG + Intronic
989721428 5:44533489-44533511 ATACAGGAAGGAAAGAGAGAAGG - Intergenic
990540289 5:56765836-56765858 ATCCTGGAAGGAAAAAGCAATGG - Intergenic
990550674 5:56875070-56875092 AAACTGGAATGTGAGAGAGATGG + Exonic
991632113 5:68666663-68666685 CCCCTGGAAGGTATGATAGAGGG - Intergenic
992601870 5:78409214-78409236 ATCCTGGGAGGCAAGAAAGCAGG - Intronic
993569715 5:89522146-89522168 AGGCTGGCAGGAAAGAGAGAAGG - Intergenic
993607967 5:90017466-90017488 ATTCTGAAAGGTACGTGAGATGG - Intergenic
994023402 5:95053832-95053854 AACCTTGAAGGGAAGATAGAAGG + Intronic
994301837 5:98157057-98157079 ATCCTGGAAGGTGAGTGTGAAGG - Intergenic
995121755 5:108543365-108543387 AGCATGGTAGGTAAGAGAGTCGG - Intergenic
996118058 5:119640383-119640405 GTACTAGAAGGTCAGAGAGAGGG - Intergenic
996677993 5:126198574-126198596 AGCCTGGAAGGTGGGAGTGAGGG + Intergenic
998036786 5:138924080-138924102 CTCCTGGAAGGAGAGGGAGAGGG + Intronic
999499174 5:152129643-152129665 ATCCTGGAAGAAAGCAGAGATGG - Intergenic
999587936 5:153111388-153111410 ATCCTGGCAGGCCAGGGAGATGG + Intergenic
1001373819 5:171235012-171235034 ATGTTGGAAGGTAAGAAAGAAGG + Intronic
1001863482 5:175081304-175081326 ATCCTGGAAGGGCAGAGAAGTGG - Intergenic
1002466184 5:179410045-179410067 GTCCTGGAAAGTCACAGAGATGG + Intergenic
1002862598 6:1093535-1093557 CTCCTGGGAGGGGAGAGAGAGGG - Intergenic
1004454550 6:15779744-15779766 ATCCAGGAGGGTAAGAGAGCAGG - Intergenic
1005902151 6:30226089-30226111 AATCTGGAAGGTAAGAGAAAAGG - Intergenic
1006402548 6:33826178-33826200 ACCCTGGAAAGTGGGAGAGAAGG - Intergenic
1006856597 6:37137926-37137948 ATCCTGAAAGTTTGGAGAGAAGG + Intergenic
1007445453 6:41902129-41902151 ATCCTGGAAGGTAAGGGTTGTGG - Intergenic
1007753054 6:44081613-44081635 ACCCTGGAGGGCAAGAGGGAGGG - Intergenic
1008808796 6:55466602-55466624 AACATGGAAGGCCAGAGAGAGGG - Intronic
1008962338 6:57278405-57278427 CACATGGAAGGGAAGAGAGATGG - Intergenic
1009021142 6:57949185-57949207 GTCCTGGAAGGTGGGAGAAATGG - Intergenic
1010933909 6:81837306-81837328 ATGCTGGAAGAGAAAAGAGAAGG - Intergenic
1011379576 6:86728226-86728248 AGGCTGGGAGGTAAGAGAAATGG + Intergenic
1011423745 6:87203524-87203546 ATTCAGGAAGGGAAGAGAAACGG - Intronic
1012600159 6:101086692-101086714 AGAATGGAAGGAAAGAGAGATGG - Intergenic
1015254803 6:131166198-131166220 ATCCTGCAAGGACAGAGAGGAGG + Intronic
1015392624 6:132700368-132700390 ATGCTGTAAGGTGAAAGAGAGGG + Intronic
1015685843 6:135858567-135858589 ATCCTGGAAGCCAGGAGATAGGG + Intronic
1015919560 6:138253460-138253482 CTCCTGAGAGGTGAGAGAGAAGG + Intronic
1016370129 6:143365196-143365218 AAGCTGGAAGGGAAGAGAGTTGG - Intergenic
1017674024 6:156795345-156795367 AGGCCGGAAGGTAGGAGAGAAGG + Intronic
1018377303 6:163225399-163225421 ATGGTGGCAGGTGAGAGAGAGGG - Intronic
1020741793 7:12029254-12029276 GTGATGGAAGGCAAGAGAGACGG + Intergenic
1020827311 7:13045747-13045769 ATGCAGGGAGGGAAGAGAGAGGG + Intergenic
1021920860 7:25483577-25483599 AACCAGGAAGGCCAGAGAGAAGG + Intergenic
1022615123 7:31921429-31921451 ATCCTGGAAGGTGAGAAATTGGG - Intronic
1023643728 7:42287714-42287736 ATCAATGAAGGTAAGATAGAGGG - Intergenic
1023738352 7:43254732-43254754 GTGCTGGAAGCGAAGAGAGATGG - Intronic
1024282799 7:47733335-47733357 AGCCTGGAAGGTAGGTGGGAAGG + Intronic
1024977951 7:55131065-55131087 CTCCTGGGAGGGAAGTGAGAGGG - Intronic
1026737747 7:72959906-72959928 CTTCTGGAAGGCAAGAGAGAGGG + Exonic
1026788782 7:73318707-73318729 CTTCTGGAAGGCAAGAGAGAGGG + Exonic
1027105987 7:75405162-75405184 CTTCTGGAAGGCAAGAGAGAGGG - Exonic
1028123962 7:87090092-87090114 AGCCTGGAAGTTAAGAGATTGGG + Intergenic
1028331503 7:89600379-89600401 ATCCTGGAAGGGAAGATTAATGG - Intergenic
1028525048 7:91774815-91774837 TTCCTGGCAGGGAAGAAAGAAGG + Intronic
1028783617 7:94766854-94766876 ATGGTGAAAGGCAAGAGAGAGGG - Intergenic
1030441435 7:109593824-109593846 ATTTTGGAAGTTATGAGAGATGG + Intergenic
1030527178 7:110668275-110668297 TTCCTGGAAGTTAACATAGATGG - Intronic
1030586363 7:111424283-111424305 AGCCAGGAAGGAAGGAGAGAAGG + Intronic
1031706992 7:124993565-124993587 ATGGTGGAAAGTAAGAGAGAAGG + Intergenic
1032206907 7:129873842-129873864 AGCTGGGAAGGTAAGAGAAATGG - Intronic
1032627319 7:133605970-133605992 GTCCTGGAAGCTAAGTGAGAAGG + Intronic
1032738297 7:134712950-134712972 ATCCTTGAATGAAAGAGGGAAGG - Intergenic
1033211482 7:139463232-139463254 ACCCTGAAAGGTCAGAAAGAAGG + Intronic
1033596509 7:142863318-142863340 GCTCTGGAAGGTAAGAGGGAGGG + Exonic
1033956355 7:146853619-146853641 ATCCTGAGAGGTAAGAGACCAGG + Intronic
1034461868 7:151202228-151202250 CTCCTGGAAACTAAGACAGAGGG - Intronic
1034699782 7:153085880-153085902 ATCCTTGAAGCTAGGAGAGACGG - Intergenic
1035045563 7:155963266-155963288 ATTCTGCCAGGTAAGAGACAGGG + Exonic
1037022900 8:13995786-13995808 ATCCTTCAAGGCAAGAGAGATGG + Intergenic
1037608783 8:20459147-20459169 GTCCAGGAAGGTATGTGAGAAGG + Intergenic
1038006705 8:23436606-23436628 ATCCTGGCAGGTCAGGGAGGGGG + Intronic
1038431212 8:27501288-27501310 TTGTTGGAAGGTAAGAAAGAGGG + Intronic
1038553759 8:28491964-28491986 AACATGGAATGAAAGAGAGATGG + Intergenic
1038649851 8:29392720-29392742 AACCTGGAAGTTAAGAGACCTGG + Intergenic
1038756348 8:30344486-30344508 ATCCTAGAAGATAACATAGAAGG - Intergenic
1038933338 8:32220024-32220046 ATTCTGGAAGAAAAAAGAGAAGG + Intronic
1039855142 8:41405688-41405710 ATCCTGGAATGTAAGGCAAAAGG - Intergenic
1040723548 8:50353842-50353864 ATCCAGGAAGGCAAGGGTGAAGG + Intronic
1041524205 8:58787626-58787648 ATCCTGGACAGCTAGAGAGAGGG + Intergenic
1042051460 8:64713747-64713769 ATCCCAGAAGGGAAGAGACAGGG + Intronic
1042620908 8:70703180-70703202 ATCCTAGAAGAAAAGAGAGAGGG - Intronic
1043701787 8:83298326-83298348 ATCCTGGCAGATCAGAGACATGG + Intergenic
1044854687 8:96463023-96463045 GTTCTGGAAGGAAATAGAGATGG + Intergenic
1045492541 8:102681131-102681153 ATCATGGAAGGTAAGACTGATGG - Intergenic
1046131269 8:109971619-109971641 AACCTGGGATGTATGAGAGAGGG - Intronic
1047781087 8:128111698-128111720 ACCATGGAAGGAAAAAGAGAGGG + Intergenic
1048106529 8:131416895-131416917 ATTATGGAAGGAAAGAGTGATGG - Intergenic
1049458322 8:142706628-142706650 ATCCCCAAAGGTAAGAGAGAAGG + Intergenic
1053578953 9:39383088-39383110 ATCCTGGAAACCAAGATAGACGG - Intergenic
1053639978 9:40063904-40063926 TTTCTGGATGGCAAGAGAGATGG + Intergenic
1053766155 9:41401579-41401601 TTTCTGGATGGCAAGAGAGATGG - Intergenic
1054100536 9:60941892-60941914 ATCCTGGAAACCAAGATAGACGG - Intergenic
1054121932 9:61217517-61217539 ATCCTGGAAACCAAGATAGACGG - Intergenic
1054320729 9:63660219-63660241 TTTCTGGATGGCAAGAGAGATGG + Intergenic
1054544771 9:66312734-66312756 TTTCTGGATGGCAAGAGAGATGG - Intergenic
1054585810 9:66964994-66965016 ATCCTGGAAACCAAGATAGATGG + Intergenic
1055096059 9:72415272-72415294 ATCCTGGATGGCAAGAGGAAGGG - Intergenic
1055421362 9:76146662-76146684 ATCCTGCAAGGTAATAAAGGGGG - Intronic
1055590329 9:77805807-77805829 ATTCTGGAGGATAAAAGAGAAGG + Intronic
1058404416 9:104655665-104655687 AGCTTAGAAGGTAGGAGAGAAGG + Intergenic
1058633106 9:107009445-107009467 ATCAGTGAAGGTAGGAGAGAGGG + Intronic
1058636587 9:107044089-107044111 ATCCTGGCAGGAAAGAGAAAAGG + Intergenic
1058654082 9:107203860-107203882 TTCCTGTGAGATAAGAGAGAGGG + Intergenic
1058850395 9:109006460-109006482 ATCCTGGAAGGTAAGAGAGACGG - Intronic
1059023835 9:110603717-110603739 ATTCTGAAAGGAAAGAGAGAGGG - Intergenic
1060013842 9:120068887-120068909 ATCCTATAAGGAAAGAGTGAAGG + Intergenic
1060529473 9:124339896-124339918 GTCCAGGAAGGGAAGACAGAGGG + Intronic
1061085381 9:128395029-128395051 ATGCTGGAGGATAAGACAGAAGG + Intergenic
1062265377 9:135684460-135684482 ATCCTGGCAGGGAAGAGCCATGG + Intergenic
1185568084 X:1111957-1111979 TTCCCGGAAGCTCAGAGAGAAGG + Intergenic
1186917021 X:14233918-14233940 ACCCAGGAAGCAAAGAGAGATGG - Intergenic
1187016814 X:15337035-15337057 ATCCTGGAAGGTATAAATGAGGG + Intergenic
1187246637 X:17558751-17558773 ATTTTGGAAGGTAAGAGACCTGG - Intronic
1187254980 X:17634456-17634478 AAGCTGAAAGGGAAGAGAGAAGG - Intronic
1187785172 X:22876714-22876736 AGGATGGAAGGTAAGCGAGATGG - Intergenic
1189165698 X:38858725-38858747 AAGCTGGAAGGTCAGAGAAATGG + Intergenic
1190285139 X:48956802-48956824 ATCCTGGAGGGGAGGAAAGAAGG + Intronic
1190598412 X:52067696-52067718 ATTCTGCAAGGCCAGAGAGAGGG + Exonic
1190610412 X:52186377-52186399 ATTCTGCAAGGCCAGAGAGAGGG - Exonic
1191674486 X:63780057-63780079 ATTTTGGAAGGCAAAAGAGAAGG - Intronic
1193197853 X:78655540-78655562 ACCCTAGAAGGTAATAGGGAAGG - Intergenic
1193665641 X:84312458-84312480 AGACAGGAAGGTAAGAAAGAAGG + Intergenic
1193902280 X:87196057-87196079 ATGGTGGAAGGTTAAAGAGAGGG - Intergenic
1194091495 X:89584959-89584981 CTCCTGCAAGGTTTGAGAGAAGG - Intergenic
1195553898 X:106199592-106199614 ATTCTGGAAAGCAAGAGAAAGGG + Intronic
1196656258 X:118220576-118220598 AACCTGGAAGGAAACAAAGAAGG - Intergenic
1197035981 X:121873808-121873830 ATAATGGAAGGGAAGATAGAAGG + Intergenic
1197311531 X:124911324-124911346 ATCCAGGCAGATTAGAGAGAAGG + Intronic
1200444148 Y:3241129-3241151 TTCCTGCAAGGTTTGAGAGAAGG - Intergenic