ID: 1058850399

View in Genome Browser
Species Human (GRCh38)
Location 9:109006477-109006499
Sequence CAGGATTATGTTAAGGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058850395_1058850399 -6 Left 1058850395 9:109006460-109006482 CCGTCTCTCTTACCTTCCAGGAT 0: 1
1: 0
2: 2
3: 40
4: 375
Right 1058850399 9:109006477-109006499 CAGGATTATGTTAAGGATCAAGG No data
1058850393_1058850399 15 Left 1058850393 9:109006439-109006461 CCTACACTCTTAATCACTACACC 0: 1
1: 1
2: 5
3: 45
4: 247
Right 1058850399 9:109006477-109006499 CAGGATTATGTTAAGGATCAAGG No data
1058850392_1058850399 27 Left 1058850392 9:109006427-109006449 CCAGGGGAGCTACCTACACTCTT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1058850399 9:109006477-109006499 CAGGATTATGTTAAGGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058850399 Original CRISPR CAGGATTATGTTAAGGATCA AGG Intronic
No off target data available for this crispr