ID: 1058857039

View in Genome Browser
Species Human (GRCh38)
Location 9:109072586-109072608
Sequence CCCGTAGGGTACCTGAAGTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 2, 2: 9, 3: 21, 4: 49}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058857039_1058857048 14 Left 1058857039 9:109072586-109072608 CCGAACTTCAGGTACCCTACGGG 0: 1
1: 2
2: 9
3: 21
4: 49
Right 1058857048 9:109072623-109072645 GTCCCCAACACAAAAGGAGGTGG No data
1058857039_1058857045 -8 Left 1058857039 9:109072586-109072608 CCGAACTTCAGGTACCCTACGGG 0: 1
1: 2
2: 9
3: 21
4: 49
Right 1058857045 9:109072601-109072623 CCTACGGGTGGTGTTGAGGCTGG 0: 16
1: 26
2: 15
3: 10
4: 147
1058857039_1058857046 8 Left 1058857039 9:109072586-109072608 CCGAACTTCAGGTACCCTACGGG 0: 1
1: 2
2: 9
3: 21
4: 49
Right 1058857046 9:109072617-109072639 AGGCTGGTCCCCAACACAAAAGG No data
1058857039_1058857052 24 Left 1058857039 9:109072586-109072608 CCGAACTTCAGGTACCCTACGGG 0: 1
1: 2
2: 9
3: 21
4: 49
Right 1058857052 9:109072633-109072655 CAAAAGGAGGTGGCTGAATTTGG No data
1058857039_1058857053 30 Left 1058857039 9:109072586-109072608 CCGAACTTCAGGTACCCTACGGG 0: 1
1: 2
2: 9
3: 21
4: 49
Right 1058857053 9:109072639-109072661 GAGGTGGCTGAATTTGGCCCTGG No data
1058857039_1058857047 11 Left 1058857039 9:109072586-109072608 CCGAACTTCAGGTACCCTACGGG 0: 1
1: 2
2: 9
3: 21
4: 49
Right 1058857047 9:109072620-109072642 CTGGTCCCCAACACAAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058857039 Original CRISPR CCCGTAGGGTACCTGAAGTT CGG (reversed) Intronic
902956405 1:19926892-19926914 CCTGTAGAGTACCTGAAGTCCGG + Intergenic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
904049979 1:27633162-27633184 CCCGGAGGGTACATGAAACTTGG + Intronic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
908082552 1:60596937-60596959 CCAGTAGGGTACCTGGGGGTAGG - Intergenic
909177218 1:72376560-72376582 CCAGCAGAGTACCTGAAGTATGG - Intergenic
915409822 1:155691853-155691875 CCCGTAGGGTATCCGAAGTCCGG + Intronic
915410626 1:155699002-155699024 TCCGTAGGGTACCTGAAGTCCGG + Intronic
915779830 1:158535100-158535122 CCCGTAGGGTATCCGAAGTTTGG - Intergenic
921228517 1:213045139-213045161 CCTGTAGGGTACTCGAAGTCCGG + Intergenic
922756280 1:228098729-228098751 CCCATAGGCTGCCTGAAGGTGGG - Exonic
924611837 1:245579999-245580021 CCCCTGAGGTACCTGAGGTTTGG + Intronic
1066654472 10:37685671-37685693 CCTGTAGGGTACCCAAAGTCCGG - Intergenic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1096110195 12:49024220-49024242 CCCATGGGGTATCTGAGGTTTGG + Intronic
1104402943 12:128491765-128491787 CCTGGAGGCAACCTGAAGTTGGG - Intronic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1117759816 14:59015155-59015177 CCACTAGGGCACCTGAAGATAGG - Intergenic
1120036801 14:79706978-79707000 CCCGTAGGGTACCCGAAGTCCGG - Intronic
1125886871 15:43235826-43235848 CCTGGAGGGATCCTGAAGTTGGG + Exonic
1128991932 15:72267977-72267999 CCGGTAGGTCACCTGAAGTCGGG - Intronic
1134001409 16:10785897-10785919 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1134001783 16:10788520-10788542 CCCGTAAGGTACCCGAAGTCCGG + Intronic
1136415798 16:30102784-30102806 CCCGTAGGGCTCCTGATCTTTGG - Intergenic
1143621440 17:8082802-8082824 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1153830434 18:8917706-8917728 CCCGCAGGGTGCCTGACTTTGGG - Intergenic
1155159714 18:23185608-23185630 TCCTTAGGGTACCTGAAGGAGGG + Intronic
1161898548 19:7100454-7100476 CCCGTAGGGTACTCTAAGTCCGG + Intergenic
1163992616 19:21013042-21013064 CCCAAAGTGTACATGAAGTTTGG - Intergenic
1164291833 19:23876602-23876624 CCTGTGGGGTACCTGAAGTCCGG + Intergenic
1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG + Exonic
1165556436 19:36636567-36636589 CCTGTAGGGTACCTGAAGTCCGG + Intergenic
1166424734 19:42667580-42667602 CCCGTAGGGTACCTGAAGTCTGG + Intronic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
1167427336 19:49436268-49436290 CCCCTAGGGAACCTGATGTTGGG + Intronic
930429265 2:51252255-51252277 CACCATGGGTACCTGAAGTTTGG + Intergenic
933521896 2:83384360-83384382 CCCTTAGGGTCCCTGGAGTGAGG - Intergenic
933835959 2:86245709-86245731 CCCATAGGGTAGCTGAAGTCCGG - Intronic
1173230458 20:41192210-41192232 CCTCTTGGGTACCTGAGGTTGGG - Intronic
1178371104 21:32028398-32028420 CCCCAAGGGCACCTGAAGATGGG - Intronic
1179780706 21:43699027-43699049 CCCACAGCGTACCCGAAGTTCGG - Intergenic
1181142732 22:20818952-20818974 CCTGTAGGGTATTTGATGTTTGG + Intronic
1181487118 22:23238478-23238500 CCCCCAGGATACCTGAAGTTGGG + Intronic
1184548333 22:45189239-45189261 CCCGTAGGGTACCCGAAGTCTGG - Intergenic
951684155 3:25325762-25325784 CCAGTAGGGTACCTTCAGTTTGG + Intronic
952443959 3:33362202-33362224 CGTGTAGTTTACCTGAAGTTTGG + Intronic
955419793 3:58724789-58724811 CCCGTAGGGTACCCGAAGTCCGG - Intronic
958645161 3:96861006-96861028 CCAGGAGGGAACCTGTAGTTTGG + Intronic
959012108 3:101089612-101089634 CCCGTAGGGTATTTAAAGTTTGG - Intergenic
967788688 3:193524118-193524140 ATAGTAGGGTATCTGAAGTTGGG - Intronic
969647648 4:8441753-8441775 CCCGTAGGGTACTCAAAGTCCGG + Intronic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
983898020 4:173102551-173102573 CCCGCAGGGTGCCAGAATTTGGG - Intergenic
985000735 4:185480026-185480048 CCCTTAGGGTACAAGAAATTTGG + Intergenic
987562160 5:19538622-19538644 CCTGTAGGGAAGCTGATGTTTGG - Intronic
987598249 5:20030033-20030055 CCCGGAGGCTACCTGAACTTTGG + Intronic
992586453 5:78245047-78245069 CCCATAGGGTACCCAAAGTCCGG + Intronic
996746223 5:126848433-126848455 CCCAGAGGGGACCTGAAGCTGGG + Intergenic
997653110 5:135536380-135536402 CCTGGAGGGTACTTGGAGTTTGG + Intergenic
1005575777 6:27188024-27188046 CCCTTAGGGTACCTAAAGTCCGG - Intergenic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1006157416 6:32023267-32023289 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1013808462 6:114018319-114018341 CTCGTAGGGTACCCGAAGTCCGG - Intergenic
1014526209 6:122504869-122504891 TCCGTAGGGTATCCGAAGTCCGG + Intronic
1017496589 6:154988993-154989015 CCCGTAGGGTATCTGCATGTGGG + Intronic
1032979521 7:137265577-137265599 CCCGCAGGGTACCAGACTTTGGG + Intronic
1037720754 8:21441855-21441877 CCCGTTGGGCAGCTGAAGCTGGG - Intergenic
1037945169 8:22985114-22985136 CCCATAGGGTACCCAAAGTCTGG + Intronic
1039264422 8:35809040-35809062 GCCCTAGGGTAGCTGCAGTTTGG - Intergenic
1044115872 8:88333110-88333132 GTCATAGAGTACCTGAAGTTTGG + Intergenic
1052993976 9:34539846-34539868 CCCGTAGGGTACCTGAAGTCTGG + Intergenic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1056886396 9:90447966-90447988 CCACTGGGGTACTTGAAGTTGGG + Intergenic
1058857039 9:109072586-109072608 CCCGTAGGGTACCTGAAGTTCGG - Intronic
1190556057 X:51637016-51637038 CCAGTAGGGTACCCAAAGTCTGG - Intergenic
1191110941 X:56802861-56802883 GTCGTAGGGTCCCTTAAGTTTGG + Intergenic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1196460115 X:115920851-115920873 CCCGCAGGGTACCGGACTTTGGG - Intergenic
1201668931 Y:16493256-16493278 TCCGTAGGGTACCCAAAGTCTGG - Intergenic
1202180163 Y:22132980-22133002 CCTGGAGGGTCCCTGAGGTTGGG - Intergenic
1202211197 Y:22453419-22453441 CCTGGAGGGTCCCTGAGGTTGGG + Intergenic