ID: 1058858123

View in Genome Browser
Species Human (GRCh38)
Location 9:109086684-109086706
Sequence GGTTAGATTTAGAGCCTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058858123_1058858126 25 Left 1058858123 9:109086684-109086706 CCACTAAGGCTCTAAATCTAACC 0: 1
1: 0
2: 0
3: 9
4: 81
Right 1058858126 9:109086732-109086754 CTGTCTTTCCCCAATAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058858123 Original CRISPR GGTTAGATTTAGAGCCTTAG TGG (reversed) Intronic
907484282 1:54766375-54766397 GGTTAGATCTGCAGCCCTAGAGG + Intergenic
907784112 1:57595355-57595377 GGTTAGATTGAGAGATTTGGGGG - Intronic
908918265 1:69158086-69158108 AGTTACATTTAGAGCTTTGGAGG + Intergenic
909849693 1:80445083-80445105 GGTTAGATATAGAGCCCTGGTGG - Intergenic
910375685 1:86567036-86567058 GGTTTGATTTATAGGCTTGGGGG + Intronic
911825121 1:102473638-102473660 TGTTACATTAAGAGCCTTATTGG - Intergenic
916088015 1:161285273-161285295 GGTTAGACTTGGAGGGTTAGCGG - Exonic
916843002 1:168619489-168619511 GGGTAGTTTCAGAGCATTAGTGG - Intergenic
920239120 1:204531116-204531138 GGTGGGATTTAGAGTGTTAGAGG + Intronic
924048530 1:240057044-240057066 AGTTAGTTTAAGAGCCTAAGGGG - Intronic
1068158994 10:53239346-53239368 GATTAGTTTTAGTGCCTTAGTGG - Intergenic
1072297626 10:94026540-94026562 GGTTAGATTTAGAGTTATAGTGG - Intronic
1072568296 10:96636433-96636455 TGTCATATTTAGAGCCTGAGAGG - Intronic
1072617892 10:97061802-97061824 GGACAGATGTTGAGCCTTAGTGG + Intronic
1082693930 11:56337026-56337048 AGGGAGATTTAGAGCCCTAGGGG - Intergenic
1088992443 11:114965462-114965484 GGCTAGATTCAGAGGCTGAGAGG - Intergenic
1092832445 12:12457880-12457902 GGTTAGATGTACAGCCTCAGTGG + Intronic
1094274003 12:28648053-28648075 ACTTAGATATAGAGCCTTTGAGG - Intergenic
1095418740 12:42003151-42003173 AGATAGATTTGGGGCCTTAGAGG - Intergenic
1096887227 12:54730238-54730260 GTTTAGACTTAGAGGCTTTGTGG - Intergenic
1098203411 12:68081181-68081203 TATTAGAGTTAAAGCCTTAGTGG - Intergenic
1101255791 12:102975214-102975236 AGCTAGATTTAGGCCCTTAGAGG - Intergenic
1101990799 12:109483193-109483215 GGTTTGAATTAGAGCTTTATGGG + Intronic
1107518064 13:41151035-41151057 GGTGAGAGTTACAGCGTTAGAGG + Intergenic
1110608595 13:77462998-77463020 GGTCATATTTAGAGATTTAGTGG + Intergenic
1115448035 14:33514285-33514307 GGTTGGATTTAGAGACAAAGAGG - Intronic
1115462348 14:33675262-33675284 GATAAAATTTAGAGCATTAGAGG + Intronic
1116035823 14:39626195-39626217 AGCTTGATTTAGAGCTTTAGAGG - Intergenic
1117635253 14:57736209-57736231 GCTTAGATTTCGACTCTTAGAGG - Intronic
1119064014 14:71507790-71507812 GGCTAGAGTTATAGCTTTAGGGG - Intronic
1120792746 14:88600086-88600108 TGTTAGATTTAAAGTCTTTGTGG - Intronic
1126127306 15:45307328-45307350 TCTTAGACTTAGAGCCTTTGAGG - Intergenic
1127999199 15:64175179-64175201 GGTCAGATTTATAGTCTTAGGGG - Intronic
1129113860 15:73353977-73353999 GGTTAAAAATAGAGCCCTAGTGG - Intronic
1133802406 16:9093792-9093814 GTTTAGATTTTGTGCCTTACTGG + Intronic
1141013472 16:80425575-80425597 TGTCAGCTTTAGAGCCTTTGGGG - Intergenic
1141814309 16:86399490-86399512 GGTGAAATGTAGAGCCTCAGTGG - Intergenic
1146517905 17:33503589-33503611 GGTAAGATGTAGAGCCTCTGTGG - Intronic
1149315830 17:55437708-55437730 GATTAGATTTAAAGCCCAAGTGG - Intergenic
1155822660 18:30397821-30397843 GGAAAGATTTGAAGCCTTAGGGG - Intergenic
1156775241 18:40779788-40779810 GAAGAGATTTAGAGACTTAGAGG - Intergenic
1159889104 18:73938011-73938033 GGTGAGATTTTGAGCCTGGGTGG + Intergenic
1164127100 19:22328473-22328495 TGTTAGATTTAGAACCTCAATGG - Intergenic
927015269 2:18952843-18952865 GGTTATATTTAGATACCTAGTGG + Intergenic
937508109 2:122559777-122559799 GGTTAGATTTACAGGTTTGGTGG - Intergenic
938732114 2:134154649-134154671 GATGAGATTTAGAGTCTCAGGGG - Intronic
939441931 2:142260887-142260909 AGTAAGATTGAGAGCCTTAGGGG + Intergenic
940524188 2:154791167-154791189 GGTTAAGATTAGAGTCTTAGTGG + Intronic
941708467 2:168685888-168685910 GCTTAGATTGAGAGAGTTAGAGG + Intronic
943709451 2:191074688-191074710 AGTTTGATTTAGTGCCTTTGGGG - Intronic
943728813 2:191280360-191280382 GGTTTGATTTAGTGGCTCAGTGG + Intronic
943789621 2:191917692-191917714 GATTATATTCAGAGGCTTAGAGG + Intergenic
1173915727 20:46707607-46707629 GGCCAGATTTAGCTCCTTAGGGG + Intergenic
1177919516 21:27133503-27133525 GGTTAGATTTAAAAGATTAGTGG + Intergenic
1180325102 22:11364976-11364998 GTTTATATTTGGAGCCTTTGAGG + Intergenic
959751356 3:109840159-109840181 GGTTAGAGATAGAGCCTAATGGG + Intergenic
978098754 4:104811552-104811574 AGATAGATGGAGAGCCTTAGGGG - Intergenic
981161249 4:141501536-141501558 GTCTAAATTTAGAGCCTAAGAGG - Intergenic
988064693 5:26219022-26219044 GGTGAGACTCAGAGCCTTACTGG + Intergenic
1000203181 5:159031798-159031820 GGTTAGATTTAGGGCCTGTGTGG - Intronic
1000994481 5:167945080-167945102 AGTTATATTTAGAGTCTCAGAGG - Intronic
1002941522 6:1720780-1720802 GGGGAGGATTAGAGCCTTAGAGG + Intronic
1003304208 6:4911730-4911752 GGTTAGTTTTAAACCTTTAGGGG + Intronic
1005236377 6:23766320-23766342 GGTTAGACTTTGTGCCTGAGAGG + Intergenic
1006097525 6:31665423-31665445 GGTCACACTTAGAGCCTAAGGGG + Intronic
1006874419 6:37282824-37282846 GGTTTGCTTTAGAGCATTTGTGG + Intronic
1010516947 6:76784854-76784876 GATTAGATTTAGAGACAGAGGGG - Intergenic
1013150640 6:107442522-107442544 GGTGAGATTTAAAGCCATAGGGG - Intronic
1013555103 6:111248794-111248816 GATTAGATTTAAAGATTTAGAGG + Intergenic
1020839009 7:13191693-13191715 GGTTACATTTAGAGCCATGTGGG + Intergenic
1021472459 7:21020358-21020380 GGTGAGTTTTAGAGCTTTATAGG - Intergenic
1024421983 7:49178896-49178918 GTTTAGATGTAGGGCATTAGTGG - Intergenic
1025780625 7:64598857-64598879 TGTGAGATTCAGAGCCTCAGTGG - Intergenic
1027584168 7:80036295-80036317 GCTTAGATTTTAAGCCCTAGAGG - Intergenic
1030066273 7:105661673-105661695 GATTTGGTTTTGAGCCTTAGAGG - Intronic
1031538543 7:122964506-122964528 AGTTAGATTTAGAGGCCTACTGG + Intergenic
1033499551 7:141934170-141934192 GGTACAGTTTAGAGCCTTAGAGG + Intronic
1033821759 7:145142870-145142892 GGTTATATTTATAGCCCAAGAGG - Intergenic
1034952052 7:155305223-155305245 GGTTAGGCTTAGAACCTCAGAGG - Intronic
1039135480 8:34318448-34318470 GTTTAAATTTAGAGTCTTAGTGG - Intergenic
1053373416 9:37582990-37583012 GGTTCGATTTTGAGCCTGGGAGG - Intronic
1055192181 9:73538743-73538765 GTTTGGATTTACAGCTTTAGTGG - Intergenic
1056653395 9:88488558-88488580 GGCTGGATTTATAGCCTCAGAGG + Intergenic
1058858123 9:109086684-109086706 GGTTAGATTTAGAGCCTTAGTGG - Intronic
1203372775 Un_KI270442v1:325887-325909 GTTTATATTTGGAGCCTTTGAGG + Intergenic
1187826950 X:23341151-23341173 ATTTAGATATAAAGCCTTAGTGG + Intronic
1188176284 X:26994710-26994732 TTTTGGATTTAGGGCCTTAGAGG - Intergenic
1189206882 X:39248464-39248486 GGGTAGCTTGAGAGCCTGAGAGG - Intergenic
1192799154 X:74449435-74449457 GGTTATATCTTGAGCCTTTGGGG - Intronic
1194155434 X:90381836-90381858 TGTTATATTTAGGGCCTCAGTGG + Intergenic
1200501782 Y:3958769-3958791 TGTTATATTTAGGGCCTCAGTGG + Intergenic