ID: 1058859116

View in Genome Browser
Species Human (GRCh38)
Location 9:109097207-109097229
Sequence CTCTAAGACACCAGTCTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058859116_1058859120 2 Left 1058859116 9:109097207-109097229 CCTGAGAGACTGGTGTCTTAGAG 0: 1
1: 0
2: 1
3: 6
4: 126
Right 1058859120 9:109097232-109097254 CAGGGGTAGAAAAGTGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058859116 Original CRISPR CTCTAAGACACCAGTCTCTC AGG (reversed) Intronic
901368784 1:8778207-8778229 CTTTAAGACAACAGTCTATGTGG - Intronic
905251903 1:36654674-36654696 CTCTCAGACAGGAGTCTTTCTGG + Intergenic
909825822 1:80126317-80126339 CATTAAAACTCCAGTCTCTCTGG - Intergenic
910009198 1:82439656-82439678 CACTAAAATTCCAGTCTCTCAGG - Intergenic
910109162 1:83663676-83663698 CTCTAAGACTGCACTCTTTCTGG - Intergenic
912175839 1:107155074-107155096 CCCTAAAGCATCAGTCTCTCTGG + Intronic
914807976 1:151005605-151005627 CTCTGAGACCCCACTCCCTCAGG - Intronic
916126945 1:161580195-161580217 CTCCAAAACACGAGTTTCTCTGG - Intergenic
916136864 1:161661999-161662021 CTCCAAAACACGAGTTTCTCTGG - Intronic
923032799 1:230263304-230263326 CTGTCAGACACCAGTCCTTCAGG - Intronic
923505837 1:234606519-234606541 CTCTCAGTCATCAGTATCTCAGG + Exonic
1064602875 10:17011174-17011196 CTCTAAGACAGTAGTGTGTCTGG + Intronic
1069110946 10:64445565-64445587 CAATTAGACACCAGTTTCTCAGG - Intergenic
1069630311 10:69893583-69893605 CTTTGAGCCACCAGTCTCTTTGG - Intronic
1070975242 10:80601121-80601143 CTCCAAGACACCCCTCTCTCTGG - Intronic
1075872309 10:125779801-125779823 CTCTAGGACACCGGGCTTTCCGG + Intergenic
1084145485 11:67262980-67263002 CTCTTAGTCTCCAGCCTCTCTGG - Intergenic
1085300446 11:75455418-75455440 CTCTAAGACTTCAGTCTCTGGGG + Intronic
1086700675 11:89897400-89897422 ATGTAATACACCACTCTCTCAGG - Intergenic
1086705494 11:89947126-89947148 ATGTAATACACCACTCTCTCAGG + Intergenic
1086943093 11:92818231-92818253 CTCTAAAACTCCAGTCTATAAGG + Intronic
1087623061 11:100564588-100564610 TTGTAACAAACCAGTCTCTCAGG + Intergenic
1087913548 11:103781146-103781168 CTCTGAGTAACCAGTCTCACAGG + Intergenic
1092089122 12:5789648-5789670 CTAGAAGACAGCAGTCTCCCAGG + Intronic
1097160515 12:57043440-57043462 CCCCAGGACACCAGTGTCTCAGG - Intronic
1100761354 12:97810958-97810980 CTCCAGGACACCAGTCTCCTAGG + Intergenic
1101897351 12:108766711-108766733 CTCTAAGCAACCAGTGTCACAGG - Intergenic
1103727652 12:123006186-123006208 CACTGAGACACGAGACTCTCAGG - Intronic
1107676312 13:42801384-42801406 CTTTAAGACAACAGTCTGTAAGG + Intergenic
1109018338 13:57050196-57050218 CTTCAAGAGACCAGTCTCACAGG + Intergenic
1110897056 13:80767588-80767610 CTCTGAAACATCATTCTCTCAGG - Intergenic
1111834593 13:93372328-93372350 CTGTTACAAACCAGTCTCTCTGG + Intronic
1119191095 14:72682465-72682487 CTCTAACACACCAAGCTGTCTGG - Intronic
1119439648 14:74619662-74619684 CTCTAGGGCCCCAGTCCCTCAGG + Intergenic
1122300881 14:100730443-100730465 CTCTGGGACCCCAGACTCTCTGG - Intronic
1122573659 14:102726502-102726524 TTCAAAGCCACCAGTTTCTCAGG - Exonic
1129272600 15:74427340-74427362 TTCTAAGATACCTGTCCCTCTGG - Intronic
1129797899 15:78391965-78391987 CTCTAGGACACCAGTCAGCCTGG + Intergenic
1132344970 15:101102572-101102594 CTCAAAGTCACCATTCTCTGTGG - Intergenic
1141439101 16:84017810-84017832 CTCTTAGAGACCTATCTCTCAGG - Intronic
1141841676 16:86577791-86577813 CTCTGGGAGCCCAGTCTCTCTGG - Intronic
1143285921 17:5789247-5789269 CTCTAAGACACCTGGCTGTAGGG + Intronic
1143771669 17:9173099-9173121 CACTTAGAGACCAGTCTCCCTGG + Intronic
1147338042 17:39738753-39738775 CTCTAAGACAGACGTCTCTGCGG + Exonic
1147755528 17:42764757-42764779 CTCTGAGACACACATCTCTCAGG + Intergenic
1148229720 17:45924312-45924334 CTTTAAGTCACCTGTCACTCTGG + Intronic
1149267895 17:54947668-54947690 CTTTCAGACACCAGTCACTTTGG + Intronic
1149380897 17:56092857-56092879 CTCTTAGAGACCACTCTCCCTGG + Intergenic
1151104626 17:71598096-71598118 CTCAAAAACCCCAGTCCCTCTGG + Intergenic
1151160999 17:72165857-72165879 TTCAAAGTGACCAGTCTCTCTGG - Intergenic
1155595272 18:27478711-27478733 TTCTTAGACACTAGTCACTCTGG + Intergenic
1159820199 18:73131517-73131539 CACTAAGACACTAATCTATCAGG + Intergenic
1160265729 18:77339667-77339689 CTCTAGGACACCAGGATCTCTGG + Intergenic
924972356 2:140396-140418 CTGTAAGACACCATACTCACCGG + Intergenic
925214881 2:2085822-2085844 CTCTGAGACACCGCGCTCTCAGG + Intronic
926587379 2:14702191-14702213 CTCTAAAACACAGGTTTCTCAGG - Intergenic
927826405 2:26312769-26312791 CTCTCAGACACCACTCTCTGAGG - Intronic
929804068 2:45129196-45129218 CTCTCAGACACCAATCTGTTGGG + Intergenic
930684200 2:54290257-54290279 CTTCAAGGCACCAGTCTCTGTGG - Intronic
932185852 2:69694730-69694752 GACTAAGACACCAGTCATTCTGG + Intronic
933996695 2:87675469-87675491 ATCTAGGAATCCAGTCTCTCTGG - Intergenic
936297158 2:111275441-111275463 ATCTAGGAATCCAGTCTCTCTGG + Intergenic
937621829 2:123997267-123997289 GTTTAAGCCACCAGTATCTCTGG + Intergenic
937698521 2:124836921-124836943 TTCTAAGACACCTATCTCTAAGG + Intronic
940079015 2:149778958-149778980 TTCTAGGACACCACTCGCTCAGG - Intergenic
940690089 2:156905674-156905696 CTCTAAGAAAACAGTCTTTGGGG + Intergenic
946972425 2:225109582-225109604 CTCTCAGACACAAGTCTGTATGG - Intergenic
948346772 2:237305281-237305303 CTCTAAGATTCCAGTGTCTTGGG + Intergenic
1170391823 20:15883256-15883278 CTGTATGACAACAGACTCTCTGG - Intronic
1171533233 20:25865797-25865819 GTCTTAGAAACCAGTCTCTGAGG - Intronic
1172596818 20:36155530-36155552 CCCTGAGACCCCAGCCTCTCGGG - Intronic
1175776496 20:61657000-61657022 CTCTAAGACACATGCCTCTGGGG - Intronic
1177926072 21:27217214-27217236 CTCTGGGACACCCCTCTCTCTGG + Intergenic
1178751162 21:35304321-35304343 CTCTAAGTCTCAAGTCTCTAAGG + Intronic
1179362149 21:40720004-40720026 TTCTAAGACATCACTCTCTAGGG - Intronic
1180748386 22:18108096-18108118 CTCTTCAACACCAGTCTTTCTGG + Intronic
1180912790 22:19464616-19464638 CTTTCTGACACAAGTCTCTCAGG - Intronic
1183712343 22:39512578-39512600 CTGTAAGACCTCAGTCTTTCTGG - Intronic
1184897721 22:47421530-47421552 GTATAAGACATCAGTTTCTCAGG - Intergenic
953348116 3:42192997-42193019 CACAAAGAAACCATTCTCTCTGG + Intronic
954998574 3:54905056-54905078 CTATAAGAAACCAATGTCTCTGG - Intronic
960942152 3:122942184-122942206 CTCTGTGCCACCAGTCTCACAGG - Intronic
961504695 3:127362423-127362445 CTCCAGCACACCAGTCTCTAAGG - Intergenic
962207059 3:133443482-133443504 TTCCATGACACCACTCTCTCTGG - Intronic
965833785 3:172828847-172828869 CTCTCAGGCACTCGTCTCTCAGG - Intergenic
968870980 4:3242094-3242116 CTCTGAGACAGCAGTATCACAGG + Exonic
969418239 4:7074880-7074902 CTGGAAGACTCCAGCCTCTCTGG + Intergenic
970489084 4:16553933-16553955 CTCTTAGCCACCACTCTGTCTGG + Intronic
972801967 4:42485913-42485935 CTATAAGTCACCTGTTTCTCAGG + Intronic
975530239 4:75392927-75392949 GTCAAAGAAACCAGACTCTCTGG + Intergenic
979603941 4:122617084-122617106 CTCTAAGACACAAACCTATCAGG + Intronic
979696003 4:123613979-123614001 CTACCAGACACCAGTTTCTCAGG - Intergenic
981442407 4:144798463-144798485 CTCTATGATACCTGTTTCTCTGG + Intergenic
985836847 5:2277931-2277953 CTCACAGACACCAGTGCCTCAGG - Intergenic
986449060 5:7849031-7849053 CTCAAAGACACCAGTCATACTGG + Intronic
987386850 5:17338196-17338218 CTCTAGGACACCACTGGCTCTGG - Intergenic
994838607 5:104891274-104891296 TTTTAATACATCAGTCTCTCAGG + Intergenic
995636573 5:114200370-114200392 CTCTAAGATATCTGTCTCTTTGG + Intergenic
998657997 5:144204339-144204361 CTTTAAAACACCAGTGTCTTAGG - Intronic
999872098 5:155763262-155763284 CTCTAAGAGGTCAGCCTCTCTGG - Intergenic
1000689222 5:164294054-164294076 TTCTAAAAACCCAGTCTCTCAGG - Intergenic
1003621940 6:7708203-7708225 CTCTAAGGCATGAGTCTTTCTGG + Intergenic
1007772791 6:44204642-44204664 ATGTAAGATACAAGTCTCTCAGG - Intergenic
1015690800 6:135920506-135920528 TCCTAAAAGACCAGTCTCTCTGG + Intronic
1021502497 7:21346237-21346259 TTCTAAGACTCCAGTCCCTCTGG + Intergenic
1021846590 7:24768979-24769001 CTCTATGACAGCAGTCACTTAGG - Intergenic
1024847687 7:53667452-53667474 CTCTATGACAGCTGTCTCGCTGG + Intergenic
1026383552 7:69823005-69823027 CTCAAAGTCCCCAGTTTCTCTGG - Intronic
1031700461 7:124918681-124918703 TTCTGGGACATCAGTCTCTCTGG - Intronic
1032502523 7:132410582-132410604 CTCTATGACACCAGCCTCTCTGG - Intronic
1033348128 7:140541204-140541226 CAGTGAGACACCAGTCTCACTGG - Intronic
1034996147 7:155578327-155578349 CTCTCACACTCCAGGCTCTCTGG + Intergenic
1036007852 8:4687160-4687182 CACTAAGACCCCTGCCTCTCTGG - Intronic
1038400951 8:27284191-27284213 CTCTGAGACTCCAGTTTCTGAGG + Intergenic
1039477953 8:37850881-37850903 CTCTGAGAAAGCAGTCTCTTAGG - Intergenic
1041710515 8:60890085-60890107 CTCAAAGAATCCAGACTCTCTGG + Intergenic
1044562202 8:93623884-93623906 CTCAAACACACCACTCTCTTTGG - Intergenic
1045259182 8:100557420-100557442 GTCTAAGCCACCATTCTCTCTGG + Intronic
1047475854 8:125228671-125228693 ATGTAACACACCAGACTCTCTGG - Intronic
1051567813 9:18520262-18520284 GTCTAAGACAACATCCTCTCTGG - Intronic
1052022670 9:23542924-23542946 CTCTAACACACAAGTCTCAAAGG - Intergenic
1053119252 9:35533388-35533410 CTCAAAGACTTCAGTCTCTGTGG + Intronic
1053464159 9:38292712-38292734 CTCTGGGACACCAGGCTTTCTGG + Intergenic
1056779626 9:89539380-89539402 CTCTAAGACATCATCCTTTCTGG - Intergenic
1057486922 9:95492878-95492900 CTCTAAGACAGGACTCTCTGGGG - Intronic
1057855005 9:98595023-98595045 GACTAAGACACCATTCTCTGCGG - Intronic
1058859116 9:109097207-109097229 CTCTAAGACACCAGTCTCTCAGG - Intronic
1061240245 9:129366138-129366160 GTCTAAGATATCACTCTCTCTGG - Intergenic
1062199942 9:135297225-135297247 CTCCAAGCCTCCAGCCTCTCGGG - Intergenic
1187632200 X:21185980-21186002 CTTGAAGACAACAGTGTCTCTGG - Intergenic
1189090654 X:38079147-38079169 CTGTAAGATCCCAGTCTCTTTGG + Intronic
1192951915 X:76026349-76026371 GTCTAAGACACTAAGCTCTCTGG + Intergenic
1197660342 X:129164092-129164114 CTCTAGCACACCAGACTCTGAGG + Intergenic
1201175674 Y:11307299-11307321 CTCTGGGAGACCCGTCTCTCTGG - Intergenic