ID: 1058859120

View in Genome Browser
Species Human (GRCh38)
Location 9:109097232-109097254
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058859116_1058859120 2 Left 1058859116 9:109097207-109097229 CCTGAGAGACTGGTGTCTTAGAG 0: 1
1: 0
2: 1
3: 6
4: 126
Right 1058859120 9:109097232-109097254 CAGGGGTAGAAAAGTGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr