ID: 1058862925

View in Genome Browser
Species Human (GRCh38)
Location 9:109134989-109135011
Sequence AAATGACATCAAGTGCATAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 262}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058862925_1058862929 27 Left 1058862925 9:109134989-109135011 CCATTATGCACTTGATGTCATTT 0: 1
1: 1
2: 1
3: 17
4: 262
Right 1058862929 9:109135039-109135061 ATTTCTCCTCCATCCCTCCTTGG 0: 1
1: 0
2: 9
3: 33
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058862925 Original CRISPR AAATGACATCAAGTGCATAA TGG (reversed) Exonic
903232201 1:21928740-21928762 AAAAAAAATCAAGTGAATAAAGG - Intronic
903547787 1:24137428-24137450 AAATGAGATCATTCGCATAAAGG - Intronic
904168885 1:28577139-28577161 AACTGACAATAAGTGCATAGTGG - Intronic
904394649 1:30211212-30211234 GAATGACATCAATAACATAAAGG - Intergenic
904436486 1:30501594-30501616 TAAAGACACGAAGTGCATAAAGG - Intergenic
905609289 1:39335644-39335666 AAATGACCTCAAGTGAAAAAGGG + Intronic
906190017 1:43892713-43892735 ATATGACATCTAGTACATATTGG + Intronic
906593614 1:47052422-47052444 AAATGATAACAAGTTCACAAAGG + Intergenic
907867372 1:58411144-58411166 AAAAGAAATTAAGTGAATAAAGG - Intronic
908887768 1:68809925-68809947 AAATGACCTCAATTTCATATTGG - Intergenic
909892643 1:81027122-81027144 AAATCAAATCAAGTGGATTATGG - Intergenic
910224341 1:84921045-84921067 AAACCACAGAAAGTGCATAAGGG - Intergenic
911239662 1:95451370-95451392 AGCTCACATCAAGTGCCTAACGG + Intergenic
911793137 1:102044420-102044442 AAATGACATTATGTACTTAATGG - Intergenic
911987011 1:104639877-104639899 AAATGACATAAAATACATCAGGG - Intergenic
912334744 1:108851703-108851725 AAACAACATCAAGAGCAGAAAGG - Exonic
913085933 1:115436543-115436565 TAATGAAATAATGTGCATAAAGG - Intergenic
914380158 1:147108519-147108541 AAATGACAGCAACTGCACCATGG + Intergenic
916253161 1:162758422-162758444 AAATTAAATCAAGTGAAGAAGGG - Intronic
917186369 1:172361140-172361162 AAACGAGAACAAGTGCAGAAGGG - Intronic
920883739 1:209904474-209904496 ATATGACATCAAAAGCAGAAGGG - Intergenic
923027131 1:230213863-230213885 AAATGACAACAAGAGCACAAAGG - Intronic
923993051 1:239460645-239460667 AAATGACATAAAGTACAACACGG + Intronic
924142481 1:241039997-241040019 AAATGATTTCAAGTGCCCAACGG + Intronic
1063124588 10:3127399-3127421 GAATGACATCAACCGCTTAATGG - Intronic
1063789380 10:9424606-9424628 AAATGACCTCAATTTCAGAAAGG - Intergenic
1067840542 10:49673998-49674020 ACATCACATCAACTGAATAAAGG + Intergenic
1068088259 10:52401368-52401390 AATTGACTTCAGGTGCATGAAGG - Intergenic
1068351553 10:55853163-55853185 CAATGACATCAAGTGCATTGGGG + Intergenic
1068921165 10:62485952-62485974 GAATGACATCAAGTGTACATGGG + Intronic
1069155354 10:65022947-65022969 AAATAACATCAAAAACATAATGG - Intergenic
1071890161 10:89996136-89996158 AAATGACATCAAATGGTTGAAGG - Intergenic
1072695375 10:97599450-97599472 AAATGAGATCAGGAACATAAAGG + Intronic
1074976960 10:118588685-118588707 AAATGACATCCAATGAAAAATGG - Intergenic
1075232778 10:120697476-120697498 AAAAGACATAAAGTGGCTAATGG - Intergenic
1075813814 10:125248725-125248747 AAATGACATCATGTACACCAGGG + Intergenic
1076377904 10:130003668-130003690 AAATGACATCCAGGTCCTAACGG + Intergenic
1078411350 11:11122389-11122411 AAACGAACTCAAGTGCATATGGG - Intergenic
1079669968 11:23156509-23156531 AAATTACTTCATGGGCATAATGG + Intergenic
1079862802 11:25694840-25694862 AAATCACATCATGTACATACTGG + Intergenic
1079884165 11:25965162-25965184 AAATGACATCAAATGGAAAGAGG + Intergenic
1081130721 11:39376752-39376774 AAATGAAATAATGTGCAAAATGG + Intergenic
1081153048 11:39655810-39655832 AAATGCCATCCAGTTCATGAGGG + Intergenic
1085204868 11:74725451-74725473 AAATGACAACATGTACAAAAAGG + Intronic
1086197801 11:84161913-84161935 AAATTTTATCAAGTCCATAATGG + Intronic
1086354285 11:85977781-85977803 AGAAGTCATCAAGTGCATAGTGG + Intronic
1086440139 11:86821509-86821531 AAATGACAGCAACTGAACAATGG - Intronic
1087210826 11:95445145-95445167 AAATGCTTTCAAGTGCTTAACGG - Intergenic
1087465486 11:98499099-98499121 TACTGACATCAAGTGGATAAAGG + Intergenic
1088142314 11:106632430-106632452 AAATGACCTCAAGAGTAAAATGG + Intergenic
1088228072 11:107643573-107643595 AAATGACAGCAACTGAACAATGG - Intronic
1088615400 11:111621965-111621987 ATATGACAACAAGAACATAAAGG - Intronic
1088920047 11:114254065-114254087 AAATGTCACCAAATGCATTAAGG - Intergenic
1091502917 12:1036908-1036930 AAATGAAATCAAATGTAAAATGG + Intronic
1092599666 12:10045725-10045747 AAATGACATCAAAGGAAGAAAGG - Intronic
1092741953 12:11638672-11638694 AAACAACATCAAGTTCATAATGG + Intergenic
1092822896 12:12370249-12370271 AAATGACATCAAATGGAAACTGG - Intronic
1093763927 12:22940856-22940878 ATCTGACATCAATTACATAATGG - Intergenic
1094535701 12:31321090-31321112 AAATGTCATCTAGTCCAAAAAGG - Intronic
1094724395 12:33098558-33098580 AAATGAAATTGTGTGCATAAAGG - Intergenic
1095264399 12:40136747-40136769 AAATGAACTCATGGGCATAAGGG - Intergenic
1096968856 12:55649382-55649404 AAATGACATCTACTGCAGCAGGG + Intergenic
1097946737 12:65377265-65377287 AAATGATATCAAGGCTATAAAGG - Intronic
1099274927 12:80563105-80563127 TAAAGACATTAAGTGTATAATGG + Intronic
1099645887 12:85355761-85355783 AAATGAGTTCAAGTTCATAACGG + Intergenic
1099648313 12:85390074-85390096 TAATAACCTCAAGAGCATAATGG - Intergenic
1100602844 12:96126817-96126839 AAACCATATCAAGTGCATATTGG + Intergenic
1100655076 12:96635498-96635520 AAATTCCATGAAGTGCATATGGG - Intronic
1101639210 12:106574382-106574404 AAATGACAACAATGTCATAAGGG + Intronic
1103868514 12:124073418-124073440 AAGTGAAAGCAAGTCCATAAAGG + Intronic
1105994684 13:25658975-25658997 AAATGCCAACAAGTAAATAATGG - Intronic
1106835726 13:33633247-33633269 AGAGGATATCAAGTGAATAAAGG - Intergenic
1107610188 13:42105271-42105293 AAATGAGAGCAAGTGCACGAGGG + Intronic
1108905228 13:55462094-55462116 AGATGAAATCTAGTGCACAAGGG - Intergenic
1109053104 13:57509550-57509572 AAATGCCATCCATTGCATAGAGG - Intergenic
1109604074 13:64669034-64669056 AAAAGACATCAATTGGACAAAGG - Intergenic
1114851042 14:26382823-26382845 AAATGACTTGAAGTGGAGAAGGG - Intergenic
1115404380 14:32998381-32998403 AAATGGGAGCAAGTGCTTAATGG + Intronic
1115686232 14:35799148-35799170 ATATGACAACAAAAGCATAAAGG + Intronic
1116200649 14:41790927-41790949 AAAAGACATTAAGTATATAAAGG - Intronic
1116811740 14:49546037-49546059 AAATGGCATCACGTGTAGAAAGG - Intergenic
1118518293 14:66551434-66551456 AAATGACATCTAGAGTAAAATGG - Intronic
1122026720 14:98883019-98883041 AAGTGAAAGCTAGTGCATAATGG + Intergenic
1122423214 14:101590312-101590334 AAGTAACATCATGTGCATCATGG + Intergenic
1124550128 15:30673132-30673154 ATATGACAGCAATTGTATAAAGG + Intronic
1124578601 15:30931049-30931071 AAATGACTTAAAGAGTATAATGG + Intronic
1125820693 15:42627454-42627476 AAATAACTTTAAGAGCATAACGG - Intronic
1126281017 15:46949406-46949428 AAATGGTATCTAGTGCATAAAGG - Intergenic
1126777810 15:52114145-52114167 AGATGACATCCAGTTCATGATGG - Intergenic
1127663101 15:61118948-61118970 TACTGACATCAAGCGCAAAAAGG + Intronic
1128619617 15:69137728-69137750 AAATGACATAAGATGCAAAATGG - Intergenic
1130923434 15:88367578-88367600 AAATGACATTGAGGTCATAAAGG + Intergenic
1131038099 15:89238833-89238855 AAAGGACAGCAAGTACATATGGG - Intergenic
1131467266 15:92665843-92665865 GCATGACATCAAGGGGATAAGGG - Intronic
1131906785 15:97151596-97151618 AAATGACTAGAAGTGAATAAAGG - Intergenic
1134218508 16:12335076-12335098 AAATGACATCATCTGCAGCAGGG + Intronic
1134480363 16:14613792-14613814 AAATGACATCACGTGCCTCCTGG + Intronic
1137349193 16:47696325-47696347 AAATGAGAACCAGAGCATAACGG + Intronic
1139932325 16:70538216-70538238 AAATGACATTAAAGGCCTAAAGG - Intronic
1140155717 16:72424905-72424927 AAGTGACATGATTTGCATAATGG + Intergenic
1140192451 16:72829425-72829447 GAATGACATCAAGGGCATTTTGG + Intronic
1140970346 16:80006476-80006498 AAAACACATCAGGTGCAAAAGGG + Intergenic
1144391442 17:14797335-14797357 AATTGACAGAAAGTGGATAATGG + Intergenic
1144400161 17:14888990-14889012 AAAAGATAACAATTGCATAAAGG - Intergenic
1144668647 17:17118898-17118920 AAAGGCCATCAAGTGTAGAAAGG - Intronic
1145024769 17:19459877-19459899 AAATGAGCCAAAGTGCATAATGG - Intergenic
1149159443 17:53673025-53673047 AAAGGACATCAAAAGGATAATGG + Intergenic
1149959965 17:61097806-61097828 AAATTACTTAAAGTGCATTATGG + Intronic
1150568649 17:66365420-66365442 AAATGAGATCATGTACCTAAAGG - Intronic
1152188314 17:78872612-78872634 AAATGACATCATTTGCCAAAAGG + Intronic
1153205281 18:2692655-2692677 ACATGAATTCAAGAGCATAAAGG - Intronic
1153260643 18:3220983-3221005 ATATTACATCAACTGAATAAAGG + Intergenic
1155172407 18:23276624-23276646 AAATAACTTCAAGTGCATATGGG - Intronic
1158130279 18:54145373-54145395 TATTGACATCAAGTGCATAAAGG - Intergenic
1158286098 18:55884868-55884890 AAATTACATCAATTAAATAATGG - Intergenic
1159000460 18:62970250-62970272 ATATGACAACAACAGCATAAAGG - Intronic
1159011003 18:63058387-63058409 AAATCACATCAAGAGGACAAGGG + Intergenic
1159602743 18:70444385-70444407 AAATGACACCAATTACCTAATGG + Intergenic
1164677598 19:30112153-30112175 CAATTTCATCAAGTGCTTAATGG + Intergenic
1166400149 19:42472652-42472674 AAATGACATCATGTACACAAAGG + Intergenic
1168048137 19:53808853-53808875 TACTGACATCTAGTGGATAAAGG - Intronic
925488580 2:4366490-4366512 AAAAGACATAAAGTGGCTAAGGG - Intergenic
928680508 2:33697474-33697496 ATATGTCAACAAATGCATAATGG + Intergenic
929365598 2:41152506-41152528 AAATGAGATGCAGTGTATAAAGG + Intergenic
930891013 2:56388024-56388046 AAATCACATTAAGTGCTGAAGGG + Intergenic
932861599 2:75298574-75298596 AAATGAGATCATGTGGGTAAGGG - Intergenic
933086413 2:78059461-78059483 AAATGTCATCAGGTGGAAAAGGG + Intergenic
933221184 2:79690947-79690969 ATATGATATCATGTTCATAATGG - Intronic
938256032 2:129860787-129860809 AATTGAAATCAAATGCATGAAGG - Intergenic
938671773 2:133593832-133593854 TAATGACATAATGTGCATAGGGG + Intergenic
939835837 2:147128473-147128495 GAATGAAATAAAGAGCATAATGG + Intergenic
940112846 2:150173162-150173184 AAATGACAACAATAGCACAAAGG + Intergenic
941366317 2:164615968-164615990 AAAAGAGATTAAGTTCATAATGG + Intronic
941571400 2:167175311-167175333 AAAGGACATCCACTACATAATGG - Intronic
941608236 2:167627563-167627585 AAATGTCATCAAGTAGAAAAGGG - Intergenic
942325006 2:174769116-174769138 AAATGCCAACAAGTGGATTAAGG + Intergenic
943190364 2:184670364-184670386 AAATAAAATAAAGGGCATAATGG - Intronic
944246914 2:197540379-197540401 AAATGACAGCAACTGAACAATGG + Exonic
945768469 2:214009967-214009989 GAAGAACATGAAGTGCATAAAGG + Intronic
1170118728 20:12889308-12889330 AAATGACAACAAGTGCATAAAGG + Intergenic
1173168955 20:40706975-40706997 TAATGTCATTAAATGCATAAAGG + Intergenic
1174331124 20:49818857-49818879 AAATGAACTCAAGTGAATTAAGG + Intronic
1174873683 20:54206219-54206241 AAATGGTACCAAGTGCATGAAGG - Intergenic
1174947590 20:55005429-55005451 AAATGATATTAAATGCATTATGG + Intergenic
1177094267 21:16811832-16811854 AGTTGACATCAAATGCATGAGGG + Intergenic
1181007965 22:20023178-20023200 AAATGTCAGCAAGTGCACCAGGG - Intronic
1181895113 22:26100284-26100306 AAGTGATATCAAGAACATAAAGG + Intergenic
1181904774 22:26185706-26185728 AAATGAGATCATGTGAGTAAAGG - Intronic
1182486861 22:30644435-30644457 AAATGACATTATTTGCATGAGGG - Intronic
949742880 3:7256662-7256684 AAATGAGACCAAGTCCCTAAAGG + Intronic
951948565 3:28171635-28171657 ATATGGTATCCAGTGCATAATGG + Intergenic
952019910 3:29005870-29005892 AAATGAAAACAACTGAATAAGGG + Intergenic
953301410 3:41780311-41780333 AAATTAAATAAAGTGCATGATGG + Intronic
953495078 3:43378863-43378885 AAATGATGTCAAGTGAATAAAGG - Intronic
956441620 3:69286348-69286370 GTATGACATCAATCGCATAAAGG + Intronic
956891282 3:73616762-73616784 AAATGAGATGATGTACATAAGGG - Intronic
956930627 3:74039107-74039129 AAATGACATAAAGGGCTTGAGGG - Intergenic
958572469 3:95905612-95905634 AAAATATATCATGTGCATAAAGG + Intergenic
958815774 3:98913789-98913811 TAACTACATCAAGTCCATAAAGG - Intergenic
959233109 3:103682942-103682964 AAATGCCATCAAGTAAATCAAGG + Intergenic
960640952 3:119822486-119822508 AAATGACAACCAGTACATAAGGG - Intronic
965193971 3:165570539-165570561 AAATGACAGCAAGTACAGGAGGG + Intergenic
966920290 3:184606707-184606729 AAATGACATCAATGGGTTAATGG + Intronic
967568917 3:191004388-191004410 AAATGATATCACATACATAAAGG - Intergenic
970943512 4:21663236-21663258 AAATGTCATCAAATGGTTAATGG + Intronic
971398314 4:26251252-26251274 AGATGACATCATGTGCACCATGG + Intronic
972156918 4:36174735-36174757 AAATGGCATCATGTGAAGAAGGG - Intronic
972200627 4:36710348-36710370 TAATGACATTTAGTGGATAAAGG - Intergenic
972798709 4:42449355-42449377 AAATGAAACCTAGTGCATGACGG + Intronic
973570558 4:52234631-52234653 TACTGACATCTAGTGCAGAAAGG - Intergenic
974444646 4:61963878-61963900 AAAAGTAATCAAGTACATAAGGG + Intronic
975826619 4:78326500-78326522 AATTTACATTAAGTGCATATAGG + Intronic
977315328 4:95439996-95440018 AAATGTCTCCTAGTGCATAAGGG - Intronic
977429477 4:96913051-96913073 AAATGGCATCTAATACATAATGG + Intergenic
978162946 4:105571162-105571184 ACATGACATAAAATGTATAATGG - Intronic
978224649 4:106318993-106319015 AAATGCCATCAATTGTAAAATGG - Intronic
979881801 4:125969709-125969731 AAAATACATCAAGTACAAAAGGG + Intergenic
980473097 4:133274678-133274700 AAATGTCATCAAAAGCAAAATGG - Intergenic
980485895 4:133457285-133457307 AAATGGCTTCAAGTGCTTAATGG + Intergenic
980656566 4:135794481-135794503 AAAAGAGATAAAGTGCACAATGG - Intergenic
983472182 4:168171079-168171101 AAAAGATATAAAGTGAATAATGG + Intronic
983982260 4:174012839-174012861 AAATTTTCTCAAGTGCATAATGG + Intergenic
985042930 4:185910377-185910399 AAATGAAGTCAACTTCATAAAGG - Intronic
985380699 4:189391790-189391812 AAATGAGAACATATGCATAATGG + Intergenic
985586323 5:738673-738695 AAAAGACATCAAGTGGGGAAAGG + Intronic
985600912 5:830859-830881 AAAAGACATCAAGTGGGGAAAGG + Intronic
987521923 5:18996826-18996848 AAATAAAATCAAGTGGATACAGG + Intergenic
987676285 5:21076617-21076639 AATTTACATCAAATGCAAAAGGG - Intergenic
988219287 5:28320924-28320946 AAATGACCTCAAGTTAAAAATGG + Intergenic
988313009 5:29586202-29586224 AAATAACATCATGTGGCTAATGG + Intergenic
988868598 5:35362555-35362577 AACTGACATCATGGACATAATGG - Intergenic
988919148 5:35924849-35924871 ACAGGATCTCAAGTGCATAAGGG + Intronic
988997840 5:36731254-36731276 AAATGTAATCATGTACATAAAGG - Intergenic
990525838 5:56626602-56626624 AAATGACATCAATGGCAGAGTGG - Intergenic
993452310 5:88087275-88087297 AAATGAGATCAGATGCACAAAGG - Intergenic
993604658 5:89973821-89973843 AAATGACATCATATGCCTTAGGG - Intergenic
993842488 5:92897670-92897692 AAGTGTCATCAAGGGCATTAGGG + Intergenic
994536274 5:101033889-101033911 AAATGAAATACAGTGCATACGGG - Intergenic
994771451 5:103987004-103987026 TAATGAAATCAAGAGAATAATGG - Intergenic
995054859 5:107747630-107747652 ACATGACAACAGGAGCATAAGGG - Intergenic
996030156 5:118695773-118695795 AAATTTCATAAAGTTCATAAAGG + Intergenic
996410123 5:123149790-123149812 GAATGACATCAAGGGAATACAGG - Intronic
996981411 5:129500185-129500207 AAATTACATCCAGTGAAAAAGGG + Intronic
996993360 5:129664344-129664366 AAATGGAAACAAATGCATAATGG - Intronic
997036321 5:130196451-130196473 AAATGAGAACTAGTACATAAAGG + Intergenic
998718222 5:144910539-144910561 AAATTAACTCAAGTGCATTAAGG + Intergenic
999014037 5:148077657-148077679 ATATGACAACAATAGCATAAAGG + Intronic
999025471 5:148226253-148226275 AAATTACTTGAAGGGCATAAGGG - Intergenic
999605853 5:153315064-153315086 GAAGGATGTCAAGTGCATAAAGG - Intergenic
999695536 5:154185681-154185703 AAATAAGATAATGTGCATAAAGG - Intronic
1002090700 5:176804013-176804035 TAATCACATCTACTGCATAACGG + Intergenic
1004003432 6:11616579-11616601 AAATGACCTCAACTGAATTATGG - Intergenic
1004020604 6:11772914-11772936 AAATGAGACCAAGAGCATCAAGG + Intronic
1004776346 6:18850190-18850212 AAATGACATCATGTGCCTCCTGG - Intergenic
1005258310 6:24028657-24028679 AAAGGACATCAAGAACAGAAAGG + Intergenic
1006265626 6:32919723-32919745 AAAAAAAATAAAGTGCATAAAGG + Intergenic
1008744958 6:54658543-54658565 CAATGACATCCAGTGAATACAGG + Intergenic
1008833265 6:55795352-55795374 AAAGGTCATAAAATGCATAATGG - Intronic
1010337520 6:74704310-74704332 AAAGGACATCAAGGGGTTAAGGG + Intergenic
1011632084 6:89337250-89337272 ACATGAAATCAACTGGATAAAGG + Intronic
1012202939 6:96428385-96428407 AAATGACATCCACTTCAAAATGG - Intergenic
1012749250 6:103137106-103137128 AAAAAACATCAAATGCATATTGG + Intergenic
1015028364 6:128564744-128564766 GCATGTCATCAATTGCATAAAGG + Intergenic
1015548536 6:134387537-134387559 AATTGAAATCAAGTGGAAAAAGG - Intergenic
1015607899 6:134978942-134978964 AAATGACATAAGGTTAATAATGG - Intronic
1017094165 6:150789871-150789893 AAGTGAACTCAAGTGCACAAAGG + Intronic
1018144822 6:160876092-160876114 AAATGAAATAAAGGGAATAATGG - Intergenic
1018455605 6:163949120-163949142 AAATGTCATAAAGTCCAGAATGG - Intergenic
1018540752 6:164876834-164876856 AGATAACATCCAGTTCATAATGG - Intergenic
1021627188 7:22604974-22604996 AAATAAGATCCAGAGCATAACGG + Intronic
1026030652 7:66790316-66790338 AAAAGACCTCATGCGCATAAGGG - Intronic
1028080055 7:86564513-86564535 AAATTACAGCAAATACATAAAGG - Intergenic
1029867757 7:103653765-103653787 GACTGACAGCAAGTGCATGAGGG + Intronic
1030615746 7:111736440-111736462 AATTGCAATCCAGTGCATAATGG - Intronic
1031717690 7:125129097-125129119 AAATGAAATTCAGTGGATAAAGG - Intergenic
1032260312 7:130330835-130330857 AAAAGACATAAAGTCCCTAAAGG - Intergenic
1033899858 7:146123567-146123589 ATATGACATCTAATGCATAGAGG - Intronic
1035564741 8:634060-634082 AAATGACATTAAGAGTAAAACGG + Intronic
1036445724 8:8820480-8820502 CATTGAGATCAAGTGAATAAAGG - Intronic
1038012401 8:23485526-23485548 AAATGTCATTCAGTGGATAATGG - Intergenic
1039273795 8:35912630-35912652 TACTGACATCTAGTGAATAAAGG + Intergenic
1039530343 8:38255855-38255877 AATTGAAATCAATGGCATAAAGG + Intronic
1041339442 8:56826999-56827021 GAATGACATCAATGACATAAGGG + Intergenic
1042492472 8:69415772-69415794 AAATAACATCAAGAGAAAAAGGG + Intergenic
1043362202 8:79487154-79487176 AAATTAAATCAGGTTCATAATGG + Intergenic
1043966070 8:86477571-86477593 AACTAACATCATGTGCAGAAAGG + Intronic
1044490535 8:92809059-92809081 AAATGAAGTCAAGTGCAAACTGG + Intergenic
1044907763 8:97023547-97023569 TTATGACTCCAAGTGCATAAAGG - Intronic
1045784528 8:105904833-105904855 AAATGACAGCAAGGGACTAAGGG - Intergenic
1046089447 8:109482228-109482250 AACTGACACCAAGTAAATAAGGG + Intronic
1047649840 8:126908766-126908788 AAATATCATCAGCTGCATAAAGG - Intergenic
1048154045 8:131925176-131925198 AAAGGACATCATGTGAAAAAGGG - Intronic
1048349111 8:133601492-133601514 AAATTGCATCAAGTGTTTAAAGG + Intergenic
1050210836 9:3254251-3254273 AAATGACATCAACTAAATATAGG + Intronic
1050868971 9:10541387-10541409 AAATGAAATAATGTACATAAAGG - Intronic
1051801035 9:20934499-20934521 AAAAAACATCAAGTGGGTAAAGG - Intronic
1052927041 9:34026397-34026419 AGATGACATGAATTACATAATGG + Intronic
1053253731 9:36596894-36596916 AAATGACAAGAAGTATATAAGGG - Intronic
1057944153 9:99309965-99309987 AAGTGCCATCAATTGCATAGGGG - Intergenic
1058287649 9:103199726-103199748 AAATAATGCCAAGTGCATAATGG + Intergenic
1058862925 9:109134989-109135011 AAATGACATCAAGTGCATAATGG - Exonic
1059330806 9:113534316-113534338 AAATGTCACCAAGGTCATAAAGG - Intronic
1060264599 9:122103495-122103517 AAATGTCATCAAGTGATAAATGG + Intergenic
1061443549 9:130624094-130624116 GCATGAAATCAAGTGCATGAAGG - Intronic
1185954928 X:4478743-4478765 AAATGACAGCAATTAGATAACGG + Intergenic
1186924231 X:14314471-14314493 TAATGGCATCTAGAGCATAAAGG + Intergenic
1186951603 X:14632175-14632197 AAAAGACATCAAGTAAAAAAGGG - Intronic
1192214442 X:69148953-69148975 AAATGAGATAATATGCATAAGGG - Intergenic
1192849931 X:74943698-74943720 ATATGACATCAATAGCACAAGGG - Intergenic
1192859504 X:75051511-75051533 AAATGAAAGCAAGTTCATACTGG + Intergenic
1193480053 X:82016449-82016471 AAATCTCAGCAGGTGCATAAAGG + Intergenic
1193569308 X:83122799-83122821 GAATGACTTCAAGAGCTTAAAGG + Intergenic
1194002243 X:88444755-88444777 AAATGATATAAAATGCAAAATGG - Intergenic
1194080557 X:89458739-89458761 AAATGTCATCATGTGCATATTGG + Intergenic
1194231321 X:91327997-91328019 AAATTACATCAAATGCAAAATGG + Intergenic
1195215998 X:102703315-102703337 AAATGACAACAATGGTATAAAGG + Intergenic
1196072110 X:111536876-111536898 ACATGACAACAATAGCATAAAGG + Intergenic
1196352863 X:114753503-114753525 CAATTACATCATGTGCATATGGG - Intronic
1198720813 X:139617623-139617645 AGATTAAATCAAGTGCATAATGG + Exonic
1199520912 X:148734341-148734363 ACATGAGATAATGTGCATAAAGG - Intronic
1200313981 X:155111712-155111734 ATATGACATCAAATGCACAAGGG + Intronic
1200433232 Y:3114801-3114823 AAATGTCATCATGTGCATATTGG + Intergenic