ID: 1058866309

View in Genome Browser
Species Human (GRCh38)
Location 9:109165346-109165368
Sequence ATGTCCTTGTTCAAGATTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 176}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058866309_1058866317 22 Left 1058866309 9:109165346-109165368 CCCTCAATCTTGAACAAGGACAT 0: 1
1: 0
2: 0
3: 17
4: 176
Right 1058866317 9:109165391-109165413 GATGAGGACAAAGCCTCAGGGGG No data
1058866309_1058866313 6 Left 1058866309 9:109165346-109165368 CCCTCAATCTTGAACAAGGACAT 0: 1
1: 0
2: 0
3: 17
4: 176
Right 1058866313 9:109165375-109165397 TGGCTTCTACTGTACTGATGAGG No data
1058866309_1058866318 26 Left 1058866309 9:109165346-109165368 CCCTCAATCTTGAACAAGGACAT 0: 1
1: 0
2: 0
3: 17
4: 176
Right 1058866318 9:109165395-109165417 AGGACAAAGCCTCAGGGGGATGG No data
1058866309_1058866314 19 Left 1058866309 9:109165346-109165368 CCCTCAATCTTGAACAAGGACAT 0: 1
1: 0
2: 0
3: 17
4: 176
Right 1058866314 9:109165388-109165410 ACTGATGAGGACAAAGCCTCAGG No data
1058866309_1058866315 20 Left 1058866309 9:109165346-109165368 CCCTCAATCTTGAACAAGGACAT 0: 1
1: 0
2: 0
3: 17
4: 176
Right 1058866315 9:109165389-109165411 CTGATGAGGACAAAGCCTCAGGG No data
1058866309_1058866316 21 Left 1058866309 9:109165346-109165368 CCCTCAATCTTGAACAAGGACAT 0: 1
1: 0
2: 0
3: 17
4: 176
Right 1058866316 9:109165390-109165412 TGATGAGGACAAAGCCTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058866309 Original CRISPR ATGTCCTTGTTCAAGATTGA GGG (reversed) Intronic
902395081 1:16128174-16128196 GTGACCTTGATCAAGTTTGATGG - Intronic
905847977 1:41249485-41249507 ATGGCGTTATTCAAGATTTATGG + Intergenic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
908976725 1:69907685-69907707 GTGTCCTTGATGAACATTGATGG - Intronic
908978398 1:69925224-69925246 ATATCCTTGATGAACATTGATGG - Intronic
909036289 1:70597543-70597565 ATATCCTTGATGAACATTGATGG - Intergenic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909429228 1:75567525-75567547 ATGGCCTGGTTCAATATTGTTGG + Intronic
909666299 1:78137444-78137466 AAGTCATTGTTCATTATTGATGG + Exonic
910431694 1:87165984-87166006 AAGTCCTGGTTCAAGTCTGAAGG + Intronic
911929624 1:103885367-103885389 ATATCCTTGATGAACATTGATGG - Intergenic
913930971 1:124964263-124964285 ATATCCTTGATGAACATTGATGG - Intergenic
914770930 1:150684170-150684192 AAGTCCAAGATCAAGATTGATGG - Intronic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919573315 1:199275729-199275751 AAGCCCTTGTACAATATTGATGG + Intergenic
922075211 1:222236784-222236806 ATGCCCTTGGTCAAGAGTGGGGG + Intergenic
922871442 1:228905156-228905178 ATGTCCTTGTTCAAGAACAAGGG + Intergenic
923110457 1:230885754-230885776 TTATCCTTCTTCAAGGTTGAAGG + Intergenic
923387362 1:233478494-233478516 ATGTCTTTCTTCAAGATGGCAGG + Intergenic
924594678 1:245434905-245434927 ATATCCTTGTACAAGGATGAGGG - Intronic
924762312 1:246999721-246999743 ATATCCTTGCTCTAGATTGGTGG - Intronic
1063295625 10:4802652-4802674 TTATCCTTGTACAAGTTTGATGG + Intronic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1070649626 10:78225547-78225569 AGGCCCTTGTCCAAGATTGCAGG + Intergenic
1070663965 10:78330451-78330473 ATGTGTATGTTTAAGATTGAGGG - Intergenic
1071213690 10:83373921-83373943 ATGTCCTTGTTTAACAAGGATGG - Intergenic
1071840906 10:89470307-89470329 CTGTCCTTGGTCAAGACTTAGGG - Intronic
1071933073 10:90495981-90496003 ATGTCTTTGTTCCAGAATGAAGG + Intergenic
1072125835 10:92444549-92444571 ATGTCCTGGTTCCAGATTCCAGG + Intergenic
1072778271 10:98223256-98223278 ATATCCTTGATGAACATTGATGG + Intronic
1073833852 10:107418228-107418250 TTGTACTTGTTCAACCTTGAAGG + Intergenic
1077075866 11:701838-701860 ATGTTCTTGTACAAGATTCAAGG + Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1080303224 11:30808383-30808405 CTGTCCCAGTTCAAGTTTGAAGG + Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083911927 11:65714875-65714897 ATCTCCTTCTTTGAGATTGATGG + Exonic
1084897812 11:72287614-72287636 TTATCCTTGTAAAAGATTGATGG - Intergenic
1086785798 11:90968699-90968721 ATATCCTTGATGAACATTGATGG - Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1089811233 11:121133531-121133553 AAGTCATTGTTCCAGATTAAAGG - Intronic
1090151724 11:124391829-124391851 ATATCCTTGATGAACATTGATGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1094285749 12:28791426-28791448 ATGTCCTAGTTCAAGTCTGAAGG - Intergenic
1095414204 12:41958193-41958215 ATGACATTGTTCAGAATTGAAGG - Intergenic
1096097976 12:48949844-48949866 AGGTCCTTTTCTAAGATTGAGGG - Intronic
1096124365 12:49108923-49108945 ATGACTTTGTTCTAGATCGATGG - Intronic
1096202440 12:49694557-49694579 ATGTCCGTGGTCAATATTAATGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098326125 12:69303628-69303650 TTGTTCTTTTTCAAGATTGTGGG + Intergenic
1098594544 12:72256399-72256421 AGATCCTTGTTCAAATTTGAGGG + Intronic
1099482760 12:83189343-83189365 ATTTCCTTGCCCAATATTGAAGG + Intergenic
1100120739 12:91366725-91366747 ATTTCCTTCTTCAAGCCTGAGGG + Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1103751319 12:123165273-123165295 ATTTCCTTGTTTGAGATAGATGG - Intronic
1103855829 12:123970752-123970774 CTGACCTTGTTCCAGATAGAAGG + Intronic
1105321903 13:19333295-19333317 ATGTCTTTTTTCAAATTTGATGG - Intergenic
1106295989 13:28414055-28414077 ATGTCATTGGCCAACATTGAGGG + Intronic
1106593509 13:31118031-31118053 ATGTCCTTCTGCAGGATTCAGGG + Intergenic
1108702991 13:52959523-52959545 ATGTCCCTTTGCAAGAGTGAGGG + Intergenic
1108764019 13:53604598-53604620 ATGTCCTAGTTCAAGTCAGAAGG - Intergenic
1108948303 13:56052208-56052230 ATGTAATTGTTGAAGATTCATGG - Intergenic
1111248189 13:85569458-85569480 ATATCCTTGATGAACATTGATGG - Intergenic
1111322396 13:86648031-86648053 ATATCCTTGATGAACATTGATGG - Intergenic
1118292342 14:64538747-64538769 AGGTACCTGTTCAAGCTTGATGG + Intronic
1118429182 14:65698871-65698893 ATGTCCTTGTTCCAGACTTATGG + Intronic
1120550102 14:85859817-85859839 ACGTCCTTGTTTAAGATTTATGG - Intergenic
1124806838 15:32892482-32892504 ATATCCTTGTTGAACATAGATGG - Intronic
1126125951 15:45294469-45294491 TTGTCCTTGCTCAAGAAGGAGGG - Intergenic
1126947539 15:53839872-53839894 ATATCTTTGTTAAAGATTTATGG + Intergenic
1128650945 15:69413305-69413327 ATGTCCTTGGCCAATATTGTTGG - Intergenic
1131405849 15:92163824-92163846 ATTTCCATGTTCAAGACTGAGGG + Exonic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1134465835 16:14476794-14476816 AAGTCGTTGTTCCAGATTGGTGG - Intronic
1146416391 17:32637284-32637306 ATCTCCTACTTCAAGATTGGAGG + Intronic
1149611907 17:57963778-57963800 ATGTACATGTTCCAGATTTATGG + Intergenic
1150055338 17:62009673-62009695 ATGTCCATTTTCAACATTAAGGG - Intronic
1150607686 17:66708165-66708187 ATGTCCTTGTTCAGGAATTCAGG + Intronic
1155990977 18:32279027-32279049 ATGTACTTGTTTAACATTTAGGG + Intronic
1156167491 18:34440233-34440255 ATGTCCTTCTTCAAAATAGTAGG + Intergenic
1157543939 18:48534642-48534664 ATTTCCTTTTGCAAGATTTAAGG - Intergenic
1158161279 18:54486575-54486597 ATTTCTTTGTTCATTATTGAAGG + Intergenic
1158793798 18:60816302-60816324 ATGTCCTTTATGAATATTGATGG - Intergenic
1159509210 18:69374942-69374964 ATTTCCTTGATAAAAATTGAGGG + Intergenic
1160454368 18:78989021-78989043 ATTTCCTTTTTCAATTTTGAAGG + Intronic
929092449 2:38232828-38232850 ATGTCCTTGATAAATATTGATGG - Intergenic
931541442 2:63333967-63333989 TTGTTCTTTTTCAAGATTGTTGG + Intronic
932738728 2:74275284-74275306 ATGTCCTCATTCAGGGTTGAAGG + Intronic
933431386 2:82184217-82184239 ATGCCCATGTTAAAGTTTGATGG + Intergenic
936868423 2:117105013-117105035 ATATCCTTGATGAACATTGATGG - Intergenic
937037359 2:118793190-118793212 ATCTCCTGGTTGAAGTTTGAAGG + Intergenic
938666043 2:133538743-133538765 CAATCCTTCTTCAAGATTGAGGG - Intronic
940541076 2:155019021-155019043 ATTTTCTTTTTCAAAATTGAAGG - Intergenic
941732115 2:168930164-168930186 ATATCCTTGCTAAAGATTTATGG + Intronic
942185699 2:173422900-173422922 ATGTCCTTGTCCAGTATTGTTGG + Intergenic
942371685 2:175292689-175292711 TTGTCATTGTTAAAGAATGAAGG - Intergenic
943284085 2:185974735-185974757 ATGTCCTAGTTCAAGTCTGTGGG - Intergenic
944000973 2:194837023-194837045 ATATCCTTGATGAACATTGACGG - Intergenic
945616389 2:212073747-212073769 ATTTACTTGTTCAAGTCTGATGG - Intronic
1170586112 20:17735388-17735410 ATGTGCTTGTCAAAGTTTGAAGG + Intronic
1173281322 20:41630959-41630981 AATTCCTAGTTCAAGCTTGAAGG - Intergenic
1174070765 20:47897550-47897572 TTGTTCTTGTTCAAGTCTGAGGG + Intergenic
1174153298 20:48501106-48501128 TTGTTCTTGTTCAAGTCTGAGGG - Intergenic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951762472 3:26161754-26161776 TTGTCCTTTTGCAAGAGTGAGGG + Intergenic
952042348 3:29276477-29276499 ATGTCCTTCTTAAAGATAGAAGG + Intergenic
953457606 3:43055349-43055371 ATGGACTTGGTCAAGATTAAGGG - Intronic
956143135 3:66165772-66165794 ATTTTGTTTTTCAAGATTGATGG - Intronic
960688434 3:120317484-120317506 ATATTCTTGTTGAACATTGATGG + Intergenic
966342351 3:178939284-178939306 ATATCCTTGATGAACATTGATGG - Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
970042545 4:11811979-11812001 ATGTCCTTGATATAGATTGATGG - Intergenic
972157094 4:36177615-36177637 ATGTCCAGTTTCAAGTTTGATGG + Intronic
972192552 4:36612572-36612594 ATGTCCATGTTCCAAATTGTAGG - Intergenic
977782173 4:100993456-100993478 AAGTCCTTTTGCAAGAGTGAAGG + Intergenic
978937358 4:114394400-114394422 ATGTTCTTGTTCATTCTTGATGG + Intergenic
979301310 4:119090803-119090825 ATATCCTTGATGAACATTGATGG - Intergenic
981201305 4:141982806-141982828 ATATCCTTTTAGAAGATTGAAGG - Intergenic
981576187 4:146208298-146208320 TTGACATTGTTCAATATTGAGGG + Intergenic
982900190 4:160989199-160989221 AAGACCTTGTTGAAGCTTGAAGG + Intergenic
983179117 4:164626965-164626987 ATGTCCTTGTTCATCAGGGATGG - Intergenic
984239504 4:177200627-177200649 ATGTTACAGTTCAAGATTGAAGG + Intergenic
984891736 4:184500047-184500069 AAGTCCTGGTTCAAGTCTGAAGG + Intergenic
987127621 5:14829352-14829374 TTCTCCTTCTTCAAGCTTGATGG + Intronic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
991148236 5:63333692-63333714 ATGGCATTATTCAAGATTTATGG - Intergenic
992085324 5:73273190-73273212 GTGTCCTTTTTCACAATTGATGG - Intergenic
995384898 5:111577938-111577960 ATATCCTTGATGAACATTGATGG - Intergenic
997378858 5:133421051-133421073 AGGTCACTGTTCAAGGTTGAAGG - Intronic
1001471756 5:172018915-172018937 ATGTCTTTGGTCAGTATTGAGGG - Intergenic
1004443656 6:15677525-15677547 ATGTCCTTTTCCAAGAAGGAAGG + Intergenic
1005247723 6:23907926-23907948 ATGTCCTCCTTTATGATTGAGGG - Intergenic
1005347396 6:24904074-24904096 ATGCACTTGCACAAGATTGAAGG + Intronic
1005399731 6:25419190-25419212 ATGTGCTAGTTCAAGAATGCTGG - Intronic
1007156100 6:39745518-39745540 ATGTGCTATTTCAACATTGAAGG + Intergenic
1008033446 6:46721881-46721903 ATCTAATTGTTCAAGCTTGATGG - Intronic
1008446794 6:51600976-51600998 ATGTCCTTGTTTTAGAGAGAAGG - Intergenic
1010327277 6:74579216-74579238 ATGTCCTTGTGCCAGAGTGCAGG + Intergenic
1010619175 6:78053406-78053428 ATTTCCTTGCTCAATTTTGATGG - Intergenic
1011713328 6:90077508-90077530 ATGTCTTTATTCCAGACTGATGG + Intronic
1012348535 6:98222493-98222515 ATGTCCTTGATGAAGACAGATGG + Intergenic
1014393228 6:120891432-120891454 ATGTCCTTGATGAACATCGATGG - Intergenic
1014513378 6:122352989-122353011 ATATACTTATTCAAAATTGAAGG - Intergenic
1014603482 6:123444944-123444966 ATATCCTTGATGAACATTGATGG - Intronic
1015658065 6:135542062-135542084 ATATCCTTGATGAACATTGATGG + Intergenic
1020027199 7:4907520-4907542 ATGGTCTTCTTCAAGAGTGACGG - Exonic
1021520306 7:21533203-21533225 ATATCCTTGATGAACATTGATGG - Intergenic
1022899124 7:34784608-34784630 ATATCCTTGATGAACATTGATGG - Intronic
1024607223 7:51031817-51031839 ATGTCCCAGTTCAAGATTCTAGG - Intronic
1027354637 7:77343350-77343372 TAGTCCTTTTGCAAGATTGAGGG - Intronic
1027730317 7:81863430-81863452 AGCTCATTGATCAAGATTGATGG + Intergenic
1028365166 7:90020753-90020775 ATGTCCCTGTTCAAGTCTAAAGG - Intergenic
1028425749 7:90686543-90686565 ATGACCTTGTTGAAAATTGAAGG + Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030458104 7:109798687-109798709 ATATCCTTGATGAACATTGATGG + Intergenic
1031000775 7:116412439-116412461 ATATCCTTGATGAACATTGATGG + Intronic
1031072098 7:117173191-117173213 ATGTTCTTGTTCATTATTCATGG + Intronic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1031780631 7:125958396-125958418 ATGTGCTTGTTCCAAATTTAAGG - Intergenic
1033877187 7:145836703-145836725 ATATCCCTGATAAAGATTGATGG - Intergenic
1036421062 8:8595977-8595999 ATGTCCCTGGTCAAGGGTGATGG + Intergenic
1036924185 8:12888226-12888248 ATGTATTTGTGGAAGATTGAAGG + Intergenic
1040505112 8:48040264-48040286 ATGTCCTAGTTGAAGAATGTAGG - Intronic
1041140316 8:54811136-54811158 ATGTGCTTGTTCAAGATCAGGGG - Intergenic
1041502587 8:58554353-58554375 ATTTTCCTGTTTAAGATTGAGGG + Intronic
1047343942 8:124009398-124009420 GTGTTTTTGTTCAAGTTTGAGGG + Intronic
1049426951 8:142541934-142541956 ATGTCCTTGTTCAGCACTGCAGG - Exonic
1049521049 8:143091632-143091654 ATGTCCTTGTTCAAGCTTCCAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051756822 9:20410204-20410226 GTGTCCTTTTTCAAGGTTGTGGG - Intronic
1052650714 9:31297647-31297669 ATATCCTTGATGAACATTGATGG + Intergenic
1053256690 9:36623239-36623261 AAGTACTTGTTCAATATTGTAGG - Intronic
1055072466 9:72180887-72180909 ATGACCTTGTTTTAGATTGCTGG + Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1058866309 9:109165346-109165368 ATGTCCTTGTTCAAGATTGAGGG - Intronic
1059814079 9:117892097-117892119 ATGACCTTGATCAGGGTTGATGG - Intergenic
1060500743 9:124152294-124152316 ATGTCCTTATTCAAGACAGAAGG + Intergenic
1186423028 X:9441648-9441670 ATGTCTTTGTCCAACATTGAAGG - Intergenic
1186735751 X:12462341-12462363 ATGTCCTGGTTCAAATTTGACGG - Intronic
1186819795 X:13275945-13275967 ATGTCCTTTTTTAAGATGGTGGG + Intergenic
1187749071 X:22441716-22441738 ATATCCTTGATCAACATAGATGG + Intergenic
1188765960 X:34090845-34090867 ATGTCCTGGCTAAACATTGAAGG + Intergenic
1188796866 X:34477933-34477955 ATATCCTTGATGAACATTGATGG - Intergenic
1189678614 X:43490396-43490418 ATATCCTTGATGAACATTGATGG + Intergenic
1190481567 X:50882491-50882513 ATGTCCCTGTTCAAGAAGGAAGG + Intergenic
1191068289 X:56373832-56373854 ATATCCTTGATGAACATTGATGG + Intergenic
1193557410 X:82973110-82973132 ATGTCTTTGTTCAAATTTGCAGG - Intergenic
1194554016 X:95335810-95335832 ATATCCCTGTTCAACATAGATGG + Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1201347228 Y:12998672-12998694 ATGTCTTTTCTCAATATTGAGGG - Intergenic
1201698616 Y:16855127-16855149 ATATCCTTGATGAACATTGATGG - Intergenic