ID: 1058868037

View in Genome Browser
Species Human (GRCh38)
Location 9:109179683-109179705
Sequence TCTGATTTGCAGAATGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 306}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058868037 Original CRISPR TCTGATTTGCAGAATGTGGA TGG (reversed) Intronic
900930270 1:5732320-5732342 TCTGATTTCCAGAATCTATAAGG - Intergenic
903482059 1:23660944-23660966 TCTGAGCTGCGGCATGTGGAAGG - Intergenic
903943123 1:26945280-26945302 TCTCAGGTGCAGGATGTGGATGG + Intronic
904054589 1:27661829-27661851 TCTGATCTGCAGAAGGGGTAGGG - Intergenic
905156302 1:35986028-35986050 TATGATTTGCAAAAAGTGCAAGG + Intronic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906203935 1:43976931-43976953 TCTGCTTTGCAGAGTGGGGATGG + Intronic
906537197 1:46558020-46558042 TTTGATTTCCTGAATGAGGAAGG + Exonic
906570204 1:46831322-46831344 TCTAATTTGTGGAATGTGCAGGG + Intergenic
906834075 1:49064045-49064067 TCTGATTTGTAAAATGGGAATGG + Intronic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
909095595 1:71283789-71283811 TCTAATATGCAGAATCTGTAAGG - Intergenic
909349991 1:74640480-74640502 TCTGATTTGCAAAATATTTATGG - Intronic
910029110 1:82694757-82694779 TATGTGTTGCAGAATGAGGAGGG - Intergenic
913196783 1:116463487-116463509 TCTGATTTAGAGAATGTGCGGGG + Intergenic
916864982 1:168846806-168846828 TCTGATTTCCAGAATGTCAGTGG + Intergenic
917517453 1:175719808-175719830 GCTGGTTTGAAGAATGGGGAGGG - Intronic
919238182 1:194873679-194873701 TCTGATATGTAAAATCTGGATGG + Intergenic
922429654 1:225538083-225538105 TCTGATTTGCATTCTCTGGAAGG + Intronic
1063389077 10:5637165-5637187 TCTGAGTTTCACAGTGTGGATGG - Intergenic
1066180288 10:32955848-32955870 TCTCATGTGCAGAATGTTGAGGG + Intronic
1066523655 10:36251639-36251661 ACTGATTTGGGGAATCTGGAAGG - Intergenic
1066586618 10:36943517-36943539 TCTGATTTCCTGAATGAGGAAGG + Intergenic
1066679358 10:37921940-37921962 TCTAATATGCAGAATCTGTAAGG + Intergenic
1067897316 10:50197629-50197651 TCTCATTTGCAAAATGGGAATGG - Intronic
1067951656 10:50744391-50744413 TCTCATTTGCAAAATGGGAATGG + Intronic
1068055667 10:52010285-52010307 TCTAATTTCCAGAATCTGTAAGG + Intronic
1068785551 10:60968614-60968636 TCTGATTTTCAAAATGGGGAGGG + Intronic
1069132925 10:64728617-64728639 TCTGATCTGTAAAATGGGGATGG + Intergenic
1069745435 10:70712123-70712145 TGTGATTTGCAGAGTCTGGGTGG - Intronic
1071868889 10:89769779-89769801 TCTGGCATGTAGAATGTGGAAGG + Intronic
1072170070 10:92849820-92849842 CCTTATTTGTAGAATGGGGAGGG + Intronic
1073810701 10:107149537-107149559 TCTGATTAGCACAATGGTGATGG - Intronic
1074761848 10:116672752-116672774 TCTTATTTGTAGAATATGGCTGG + Exonic
1076047887 10:127309317-127309339 TCTGATATCCAGAATCTGCAAGG - Intronic
1076288204 10:129322087-129322109 TCTGATGTCAAGAATGTGAAAGG - Intergenic
1076648063 10:131967436-131967458 TTACATTTGGAGAATGTGGATGG - Exonic
1080735313 11:35008398-35008420 TCTGGTCTGCAGAAGGTGAAAGG - Intronic
1081039265 11:38191010-38191032 TTTGACCAGCAGAATGTGGAAGG - Intergenic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1084980367 11:72825613-72825635 CCAGATTTGCAGGATGGGGAGGG + Intronic
1086461787 11:87013068-87013090 TCTGAGAGGCACAATGTGGATGG - Intergenic
1087539780 11:99501853-99501875 TTTGATTTTAAAAATGTGGAAGG + Intronic
1087548759 11:99619149-99619171 TCTGATTTTAAGAATTTTGATGG - Intronic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1087912136 11:103766509-103766531 TCTGATATCCAGAATCTGTAAGG - Intergenic
1088052170 11:105530245-105530267 TCTGGTTTGGAGAGTCTGGAGGG + Intergenic
1088320343 11:108549063-108549085 TCTCATTGGCATAAAGTGGATGG - Intronic
1088389140 11:109294522-109294544 TGTAATTTGCAGCATGTAGATGG + Intergenic
1089714112 11:120339705-120339727 TCTGTTTTGCAGTTTGTGGCAGG + Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091369850 11:135048796-135048818 CCTAATTTGCGGAATTTGGAAGG - Intergenic
1091890519 12:4050295-4050317 TGTGAATTGCAGATTGTGGGAGG - Intergenic
1092703721 12:11261575-11261597 TCTGATTTACAGAATCTACAAGG + Intergenic
1093920646 12:24855960-24855982 TCTGATTTGCACATTGTTTAAGG - Intronic
1097454669 12:59783173-59783195 TTTCATATGTAGAATGTGGAAGG + Exonic
1098018483 12:66130928-66130950 TCGGATTTGGAGAATGCTGACGG + Intronic
1098621715 12:72608951-72608973 TTTGATCTGTAGAATGGGGATGG + Intronic
1098700754 12:73622493-73622515 TCTGATATCCAGAATCTGCAAGG - Intergenic
1099611896 12:84883820-84883842 GGTGATTAGCAGAATGAGGAAGG + Intronic
1100258387 12:92907382-92907404 TCTGAGATGGAGAATGTAGATGG - Intronic
1101055565 12:100909104-100909126 TTAAATTTGAAGAATGTGGATGG + Intronic
1102806916 12:115790120-115790142 TGTCATTTGCAGAACATGGATGG - Intergenic
1103984640 12:124759194-124759216 TCTGATTTGGGGGATGGGGAAGG - Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106207137 13:27609723-27609745 TCCCTTTTGCAGAATGTAGAAGG - Intronic
1107571895 13:41670291-41670313 ACTAATTTGAAGAATGAGGAAGG - Intronic
1107771820 13:43794949-43794971 TCAGATTTGCAGAATGGGATGGG - Intergenic
1108705287 13:52979941-52979963 CCTTATTTGCAAAATGTAGATGG + Intergenic
1108912734 13:55577144-55577166 TGTGATATGCAGAAAGGGGAAGG - Intergenic
1110659358 13:78041358-78041380 TCTGATTTGCTTAATTTTGATGG + Intergenic
1110972907 13:81788854-81788876 AGTCATTTGCAGAACGTGGATGG - Intergenic
1111738568 13:92173784-92173806 AAATATTTGCAGAATGTGGAAGG + Intronic
1111813227 13:93118552-93118574 GGTGATTTGCAGCCTGTGGAAGG + Intergenic
1111975290 13:94960927-94960949 CCTGATTTTCAAAATGTGGTAGG + Intergenic
1112111881 13:96310393-96310415 TTGGGTTTGCAGAAGGTGGAAGG + Intronic
1112978584 13:105352811-105352833 TCTGGTTTGGAGAATGTGGTAGG - Intergenic
1113365600 13:109672779-109672801 TATGGTCAGCAGAATGTGGAAGG - Intergenic
1113813310 13:113154763-113154785 TCTGATGTCCACATTGTGGATGG - Intergenic
1114179512 14:20353822-20353844 TCTGAGTTGTAAAATGTGGGAGG + Intronic
1114539897 14:23447195-23447217 TCTTATCTGTAAAATGTGGATGG + Intergenic
1115008510 14:28515859-28515881 TTTGATATGCAGAATTAGGAAGG + Intergenic
1115329079 14:32174669-32174691 TGTCTTTTGCAGCATGTGGATGG - Intergenic
1115658678 14:35468484-35468506 GCTGATCTGCAGAATGATGAAGG + Intergenic
1116592033 14:46789325-46789347 GCAGACTTGCAGAATGTAGAAGG - Intergenic
1116939517 14:50776953-50776975 TATGGTTTACAGAATGTGGATGG - Exonic
1117838326 14:59830736-59830758 TCTGATCTGCAAAATGAGGATGG + Intronic
1121564898 14:94901884-94901906 TCTGCTTTGCAGAAGCTGGGAGG + Intergenic
1121893468 14:97621595-97621617 TCTGATTTGCAGAATTTTTATGG + Intergenic
1121917630 14:97850709-97850731 TCAGCTTAGCAGAATGTGCAAGG + Intergenic
1122416731 14:101553414-101553436 TCTGGCTTGCACAATGGGGAGGG - Intergenic
1124403114 15:29367669-29367691 ACTGCCTTGCAGAATGTGGAAGG + Intronic
1124554529 15:30712147-30712169 TCTGAAATGCAGAATGTGGCTGG - Intronic
1124676720 15:31693530-31693552 TCTGAAATGCAGAATGTGGCTGG + Intronic
1124812717 15:32957235-32957257 GCTGATTTTCAGAATGTCGTTGG + Intronic
1125154616 15:36571724-36571746 TCTGAATTGCAGTTTGTTGATGG + Intergenic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1127676459 15:61243892-61243914 TCTGCTGACCAGAATGTGGAAGG - Intergenic
1128805676 15:70529320-70529342 TCTGCTTAGCAGATTGGGGAGGG + Intergenic
1130764515 15:86856529-86856551 TCTGTTTGGCAGAAAGTGTAGGG - Intronic
1131586958 15:93705606-93705628 TCTCATTTGCATAATGCAGATGG - Intergenic
1133694635 16:8250224-8250246 TCTGCAATGCAGAAGGTGGAGGG + Intergenic
1137378955 16:47980012-47980034 GCTGTTCTGCAGAATGTGGAAGG - Intergenic
1137527573 16:49249771-49249793 TCTTACTTGCAGATTCTGGAAGG - Intergenic
1140971021 16:80012610-80012632 TCTTATTTGCAGAATGGGAATGG - Intergenic
1141079432 16:81037035-81037057 CCTGTTTTGCATAACGTGGAGGG - Intronic
1141268434 16:82517907-82517929 AAAGATTTGCAGAATGTGCAGGG + Intergenic
1142732839 17:1873396-1873418 TTGGATTTGTAGAATGTGGTTGG + Intronic
1144602864 17:16633906-16633928 TCTCATTTGGAGAATGGGAAAGG - Exonic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1146603996 17:34242491-34242513 TTTGTTTTGCAGAAAATGGAAGG + Intergenic
1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG + Intronic
1146967572 17:37045929-37045951 TCTGATTTGCAGAGGCAGGAAGG + Intronic
1148710222 17:49674887-49674909 ACTGTTTTGCAGATTGGGGAGGG - Intronic
1148737452 17:49872892-49872914 TGTGATTTCCAGAATTTGGCAGG - Intergenic
1148992809 17:51681191-51681213 TCTGATCTGCAAAATGGGTATGG + Intronic
1149002520 17:51771756-51771778 TCTGAGTGGCAGAATGGGGCAGG + Intronic
1150961250 17:69914731-69914753 TCTGATTGGCAGGATGTGCATGG + Intergenic
1151422997 17:74010833-74010855 TCTGATATCCAGAATCTAGAAGG + Intergenic
1151929818 17:77225291-77225313 CCTTATTAGCAGAATGAGGATGG - Intergenic
1153050650 18:900485-900507 ACTGATTTGCAATATGGGGATGG + Intergenic
1154302811 18:13209246-13209268 TGTCCTTTGCAGGATGTGGATGG - Intergenic
1154370065 18:13752322-13752344 TCTCATTTGCAGGATATGGCTGG - Exonic
1154949994 18:21200803-21200825 GCTGATTTGCTGAATGTGTGTGG - Intergenic
1154960991 18:21308535-21308557 GCTGATTGGGAGAACGTGGAGGG + Intronic
1155958109 18:31970964-31970986 TCTGACTTTCAGAAGGAGGATGG - Intergenic
1157042211 18:44053453-44053475 TTTGAATTGGAAAATGTGGAAGG + Intergenic
1157302851 18:46491950-46491972 TCTAATTTGAAAATTGTGGATGG - Intronic
1159840285 18:73391276-73391298 GCTGATTTGGAGAATATGGATGG - Intergenic
1164029231 19:21386211-21386233 TCTTATGTGCAGAAAGTTGAGGG - Intergenic
1164715683 19:30388733-30388755 TATGATTTTCAGAATTAGGATGG + Intronic
1167238410 19:48328820-48328842 TCTGCTTTGCAGAATTTTAATGG - Intronic
1167550385 19:50156238-50156260 TCTGATTGTCATAATGGGGAGGG + Intronic
1168334859 19:55591997-55592019 CTTGATCTGGAGAATGTGGAGGG - Exonic
925120154 2:1411985-1412007 TCTTCTTGGGAGAATGTGGATGG - Intronic
925182703 2:1827300-1827322 TGTGATCTGCAGGAGGTGGAAGG - Intronic
925205173 2:2000061-2000083 TCTGATTAGAATAACGTGGACGG - Intronic
926548967 2:14277897-14277919 TGTAATATGCAGAATGTGTAAGG - Intergenic
926920084 2:17931630-17931652 TCGGAGTTCCAGAATGAGGATGG + Exonic
927378234 2:22444155-22444177 TCTGATTTTCTCATTGTGGATGG - Intergenic
928498824 2:31865361-31865383 TCTCATTTGTAAAATGTGGAGGG - Exonic
928726493 2:34179784-34179806 TTAGATTTGCAGAATGTTGAAGG - Intergenic
931914585 2:66939737-66939759 ACTTATGTGCAAAATGTGGAAGG + Intergenic
932591245 2:73069205-73069227 TCTGACTTGCAGAAAGAGGAAGG + Intronic
937491837 2:122377592-122377614 CCTTATTTGCAAAATGAGGAGGG + Intergenic
938902728 2:135811750-135811772 TCAGATGGGCAGAATGTAGAGGG + Intronic
939456119 2:142437936-142437958 TTTGAGTAGTAGAATGTGGATGG - Intergenic
940589236 2:155699606-155699628 TTTGATTTGAACATTGTGGAAGG + Intergenic
942518628 2:176779615-176779637 GCTGTTTTGGAGGATGTGGAGGG - Intergenic
943674614 2:190704922-190704944 TTTGATTTGAAGAATGAGGTGGG + Intergenic
943794432 2:191974018-191974040 TCTTATTAGCAGAATGAGAATGG + Intronic
944581028 2:201133017-201133039 TCTGGTTTGCAGAGTGCTGATGG + Exonic
945305091 2:208252442-208252464 TCTGATTCTCAGAAAGTGCAAGG + Intronic
946956229 2:224932744-224932766 TGTACTTTGCAGAATGAGGAAGG - Intronic
947332850 2:229048305-229048327 GCAGATTGGCACAATGTGGATGG - Intronic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
947819056 2:233058348-233058370 TGGGATTTCCTGAATGTGGAGGG + Intergenic
948418934 2:237840687-237840709 TCTAATATGCAGAATCTGTAAGG + Intronic
948798413 2:240418923-240418945 TGTGCTTTGCAGAGTGTGGGCGG + Intergenic
1169006588 20:2212461-2212483 ACTCATTAGCAGAATGTGTAAGG - Intergenic
1169278881 20:4250560-4250582 TCATAGTTGCAGAATGAGGAGGG + Intergenic
1170738511 20:19031859-19031881 TCTGACTTGCAGAGTGTGGAAGG - Intergenic
1172101411 20:32485754-32485776 TCTCATTTTCAGAGTGAGGATGG - Intronic
1172930831 20:38585429-38585451 TCTGACTTGCAGAATATCTACGG - Intronic
1173292294 20:41725602-41725624 TCTGATTCTCAGACTATGGATGG + Intergenic
1173659065 20:44720406-44720428 TCTGGTTTGAAGAATCTGGGGGG - Intronic
1173694499 20:44997196-44997218 TCTGGTTTTCGGAATGTGGGAGG - Exonic
1174073558 20:47916062-47916084 TCTGAATTGCCCAGTGTGGATGG + Intergenic
1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG + Intergenic
1177068812 21:16475552-16475574 CAAGATTAGCAGAATGTGGAAGG - Intergenic
1177650106 21:23949362-23949384 TCTCATCTGCAGAATGGGCATGG + Intergenic
1177655414 21:24010870-24010892 TCTTATTTGACAAATGTGGAAGG + Intergenic
1177776617 21:25574975-25574997 TTTGATTTGCAGAATATTTAAGG + Intergenic
1179511608 21:41877475-41877497 CCTCATTTGCAAAGTGTGGATGG - Intronic
1180906945 22:19420573-19420595 TCTGTTTTGCAAAATGAGGGGGG - Intronic
1183964801 22:41435247-41435269 ACTGGTTTGCAGACTGTGGAAGG - Exonic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
950503611 3:13379434-13379456 TCTGATTTTCAGACCGTTGAGGG + Intronic
951280897 3:20748137-20748159 ACTGATGTGGAGACTGTGGAAGG + Intergenic
952625703 3:35400296-35400318 CCTGATTTGCAGCATATGGAAGG + Intergenic
953225261 3:41013096-41013118 TCTGATTAGCAGAATAAGGAAGG - Intergenic
953241818 3:41156128-41156150 CCTGCTTTGTGGAATGTGGATGG - Intergenic
953576663 3:44118075-44118097 TACTGTTTGCAGAATGTGGAAGG + Intergenic
953800548 3:46019497-46019519 TCTAATTTGCAGATTAGGGAGGG + Exonic
954041716 3:47892912-47892934 TCTGAGTGGTTGAATGTGGAAGG - Intronic
954342291 3:49964514-49964536 ACTCATTTGCAGATTGTGTATGG + Intronic
955011120 3:55015336-55015358 TCTGTTTTGCAGATGGTGAATGG - Intronic
955219479 3:57011874-57011896 TCTGATTTGCACTATGAGGAAGG + Intronic
956585384 3:70859086-70859108 TTTGAGTTACAGAATGTGGTAGG + Intergenic
957966790 3:87332532-87332554 TTGATTTTGCAGAATGTGGATGG + Intergenic
958159045 3:89792619-89792641 TCTTATTTCCAAAATGTGGTTGG + Intergenic
959820180 3:110724788-110724810 CCTGATCTGCAGTATGTGGCAGG + Intergenic
960500359 3:118430462-118430484 TCTGATATCCAGAATGTATAAGG - Intergenic
960500440 3:118431246-118431268 TCTGATATCCAGAATGTATAAGG - Intergenic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963574129 3:147038493-147038515 TCTGATTTCCAGAATCTATATGG + Intergenic
963924837 3:150940290-150940312 TGTGATTAGCAGAATGTGGATGG + Intronic
964036267 3:152201553-152201575 TCTGAGTTGCAGAATTTTGGAGG - Intergenic
964198755 3:154093664-154093686 TCTGATTTGCAGATTCTCAAGGG - Intergenic
964702136 3:159580245-159580267 TCTGATTTGAGGAATCTGCAGGG + Intronic
966921272 3:184613189-184613211 TCTGATACCCAGAGTGTGGATGG + Intronic
967059626 3:185860678-185860700 TCTGATATGCAGAATCTATAAGG + Intergenic
967063311 3:185891690-185891712 TCTGGTCTGCAGAATCTGAACGG - Intergenic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967816251 3:193800866-193800888 TGTGATCTGCAGATTGTGAAGGG + Intergenic
969295386 4:6267500-6267522 TCTGATTTGGTGAGTGGGGAAGG - Intergenic
969837859 4:9858012-9858034 TCTGATTTGCTGACTCTGAAGGG - Intronic
971176291 4:24285450-24285472 TCTGTTTGGCAGAATCTTGAAGG - Intergenic
971550587 4:27950966-27950988 TCTAATATCCAGAATGTGTAAGG + Intergenic
972214934 4:36886506-36886528 TCTGATATCCAGAATCTGTAAGG - Intergenic
973061599 4:45733145-45733167 TCTGATTTCTAGAATGAGGAAGG - Intergenic
974404334 4:61446504-61446526 TATGATGTGAAGAATTTGGAGGG - Intronic
975638490 4:76475275-76475297 TCTGATTTGGAGAACTGGGAAGG + Intronic
976295794 4:83470386-83470408 TCTGTATTTCAGAATGTGGTAGG - Exonic
977718125 4:100207150-100207172 GCTGAAGTGCATAATGTGGATGG + Intergenic
978292055 4:107153071-107153093 TCTGATTTGCAGGCTGCGGGTGG + Intronic
980535780 4:134120185-134120207 TCTGATTAGCATTATGTGAAGGG + Intergenic
981663427 4:147194499-147194521 TCTTATTTGCTGAACGTGGATGG - Intergenic
982238038 4:153270445-153270467 TCTGATTTGCAGTATATGCCTGG + Exonic
983115476 4:163810849-163810871 TCTGCTTTGTGGAAGGTGGATGG - Intronic
984643678 4:182198214-182198236 TCTAATCTGCAGAATGTGTAGGG - Intronic
984925353 4:184801668-184801690 TCTGATTTTCAGAATTTGTGGGG - Intronic
984950261 4:185002758-185002780 TCTGGTTTGCAGTATGTGCCAGG - Intergenic
985684069 5:1272526-1272548 TCTGATGTGGTGACTGTGGATGG - Intronic
985684076 5:1272560-1272582 TCTGATGTGGTGACTGTGGATGG - Intronic
985684082 5:1272594-1272616 TCTGATGTGGTGACTGTGGATGG - Intronic
985684117 5:1272772-1272794 TCTGATGTGGTGACTGTGGATGG - Intronic
985684131 5:1272842-1272864 TCTGATGTGGTGACTGTGGATGG - Intronic
985684191 5:1273141-1273163 TCTGATGTGGTGACTGTGGATGG - Intronic
985684219 5:1273283-1273305 TCTGATGTGGTGACTGTGGATGG - Intronic
985684233 5:1273353-1273375 TCTGATGTGGTGACTGTGGATGG - Intronic
985684272 5:1273541-1273563 TCTGATGTGGTGACTGTGGATGG - Intronic
985684279 5:1273575-1273597 TCTGATGTGGTGACTGTGGATGG - Intronic
985684304 5:1273686-1273708 TCTGATGTGGTGACTGTGGATGG - Intronic
985684311 5:1273720-1273742 TCTGATGTGGTGACTGTGGATGG - Intronic
986251088 5:6059196-6059218 ACTGATTGGCAGAATCTGAAAGG - Intergenic
986837470 5:11655378-11655400 TGTGTTTTGCAGAATGGGGGTGG - Intronic
987360983 5:17106259-17106281 TCTGCTTGGCACAATGTGGGTGG + Intronic
989192990 5:38689470-38689492 TCTGATTTGATGACTGTGGTTGG - Intergenic
992255525 5:74917202-74917224 TCTCATTGGCAGGAAGTGGAAGG - Intergenic
992497282 5:77306147-77306169 TCTGTTTTGCAGAGTCTGAATGG + Intronic
995012479 5:107273242-107273264 TCAGATATTCAGAATGTGGTTGG + Intergenic
996213974 5:120845318-120845340 TCTCATTTGCAGGATGAAGAGGG + Intergenic
996697202 5:126410989-126411011 TCTAATATGCAGAATCTAGAAGG - Intronic
997447854 5:133954665-133954687 ACTGTTTTGCAGGCTGTGGAGGG - Intergenic
997480656 5:134182132-134182154 ACTGATATACACAATGTGGATGG + Intronic
998618460 5:143767754-143767776 CCTGATTTAGAGGATGTGGATGG + Intergenic
999387207 5:151162584-151162606 TGTGAATTGCAGAATGTTGGGGG + Intergenic
999671275 5:153960763-153960785 GCTGGTTTGCAGATTGTGGGTGG - Intergenic
1001206975 5:169773086-169773108 TCAGATCTCCAGAGTGTGGAAGG - Intronic
1001448862 5:171808654-171808676 TGTCCTTTGCAGAACGTGGATGG + Intergenic
1002040515 5:176510598-176510620 TCTGATTTACAGATTCTGGATGG + Intergenic
1004339508 6:14795805-14795827 TCTGAATTGCAAAATGGGGGAGG - Intergenic
1005020894 6:21417807-21417829 TTGGATTTGCATAATGTTGACGG - Intergenic
1005424935 6:25692748-25692770 TCCGATTTACAGAATTTGAAGGG + Intronic
1005775903 6:29130439-29130461 TGAGATATGCAGAAAGTGGAGGG - Intergenic
1007319688 6:41018567-41018589 TCTCATTAGCAGAATGTGAGTGG - Intergenic
1007452438 6:41950478-41950500 TCTCATTTGCAAAAGGAGGATGG + Intronic
1008062586 6:47014171-47014193 TCTGATCTGCAAAATGAGGTTGG + Intronic
1010343046 6:74779896-74779918 TATGCTTTGCAGAATGAGAAGGG + Intergenic
1013015770 6:106159491-106159513 TCTGATCTGCAGTGTGGGGAAGG + Intergenic
1013321245 6:108991973-108991995 TAGGATTTGAAGAATTTGGATGG - Intronic
1013745532 6:113341208-113341230 TCTGCTTTGGAGAAGATGGAAGG + Intergenic
1013942219 6:115678689-115678711 TTGGATTTGCTGGATGTGGAAGG + Intergenic
1014369450 6:120586176-120586198 TATGATTTACAGAATGTGTTAGG - Intergenic
1014586866 6:123209009-123209031 TCAGAATTACAGAATGTGGCAGG + Intergenic
1014624697 6:123711241-123711263 TCTGATAAGCAGATTCTGGATGG - Intergenic
1015718053 6:136212125-136212147 TCTGAGTTGCAGTATGGAGATGG + Intergenic
1015718055 6:136212152-136212174 TCTGAGTTGCAGTATGGAGATGG + Intergenic
1015718057 6:136212179-136212201 TCTGAGTTGCAGTATGGAGATGG + Intergenic
1015718059 6:136212206-136212228 TCTGAGTTGCAGTATGGAGATGG + Intergenic
1015718061 6:136212233-136212255 TCTGAGTTGCAGTATGGAGATGG + Intergenic
1015718063 6:136212260-136212282 TCTGAGTTGCAGTATGGAGATGG + Intergenic
1017744107 6:157431503-157431525 TCTGTTTTGGAGACTGAGGATGG + Intronic
1021061503 7:16118234-16118256 TCTGAGGTACAGACTGTGGAAGG + Intronic
1021519033 7:21520037-21520059 TCAGACTTCCAGTATGTGGATGG + Intergenic
1021778536 7:24078593-24078615 TCTGATCTGCATTTTGTGGAAGG + Intergenic
1022153596 7:27636073-27636095 TCTGCTTTGCAGCATGAGGAGGG + Intronic
1026317137 7:69237208-69237230 TCAGATGTGTAGAATATGGAGGG + Intergenic
1026406930 7:70075688-70075710 TCTGATTTTCATAATGGAGAAGG + Intronic
1026428584 7:70321385-70321407 TCTGTTTTGCAGAATCTTGTTGG + Intronic
1027805694 7:82818866-82818888 TATTATTTTCAGAATGCGGATGG + Intronic
1029378659 7:100198280-100198302 CCTGAGTTGCAGTATGTTGAGGG + Intronic
1030877109 7:114827445-114827467 GCTGATTTGGAGAATGTGTGTGG - Intergenic
1030889513 7:114982176-114982198 CCTGATGTGCAGAATGGGGCAGG + Intronic
1031122607 7:117738740-117738762 TCTGATGTGCAGCAGGTGGTGGG + Intronic
1031446456 7:121860793-121860815 TCTCATTGGCAGAATTTGGGAGG + Intergenic
1031626626 7:123999753-123999775 TCTGATATGCAGAATCTATAAGG + Intergenic
1032190385 7:129762094-129762116 TCAGATTTTGAGAATCTGGATGG - Intergenic
1032996977 7:137457761-137457783 TCTGGTTTACACAATGAGGAAGG + Intronic
1033690362 7:143730481-143730503 TCTGATATCCAGAATCTGCAAGG - Intergenic
1035171273 7:157018605-157018627 TCTCATTTACAGAATGTCGCAGG - Intergenic
1035931082 8:3780866-3780888 TGAGATTTGCAGAGTGTGGAAGG + Intronic
1036397416 8:8381169-8381191 TGTGATTTGCAGACTGTGTAGGG - Intronic
1036607134 8:10317505-10317527 TCTTCTTTGGAGAAAGTGGATGG + Intronic
1038173270 8:25158271-25158293 TCTGATATCCAGAATCTGTAAGG - Intergenic
1038214102 8:25545855-25545877 TCTGATCTTCAGCATGGGGAGGG - Intergenic
1040519075 8:48159802-48159824 TCTGATTTGGAGTGTGTGGCAGG + Intergenic
1041567457 8:59295860-59295882 TCTCAATTACAGAATGTGGGTGG + Intergenic
1041733615 8:61087468-61087490 TCTGAGTTGGAGCATGAGGAGGG - Intronic
1042020295 8:64366503-64366525 TCTCCTTTGAATAATGTGGAAGG + Intergenic
1043743572 8:83844592-83844614 TCTGAACTTCAGAATGTGAAGGG - Intergenic
1044807470 8:96022896-96022918 TTTGATTGTCACAATGTGGAGGG - Intergenic
1044941909 8:97352206-97352228 TCTGATTTACAAAATGTGTTAGG - Intergenic
1045504531 8:102769179-102769201 TCTGATTTGAAGGAGGAGGATGG - Intergenic
1046378754 8:113424052-113424074 TGTGACTTACAGAATGTGAAAGG + Intronic
1047508792 8:125500336-125500358 TCTGATTTGCACAATGCTGCTGG - Intergenic
1047794091 8:128236225-128236247 TGTGATTTGCAGAATCTGGCTGG - Intergenic
1048631932 8:136252882-136252904 TTTGATTGGCAGAAGGTGAATGG + Intergenic
1049977440 9:873140-873162 TCTGATTTGCAGTTTGCTGATGG + Intronic
1050862086 9:10447738-10447760 TCTTACTTGAAGAATGAGGAAGG - Intronic
1051701357 9:19827648-19827670 TTTGATTTGCAGAATGAGGGAGG - Intergenic
1057590209 9:96366408-96366430 TCTGATTTGCAATTTGTTGAGGG - Intronic
1058693472 9:107538970-107538992 TATGCTTTGCAAAATGTTGAAGG - Intergenic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1058936506 9:109774084-109774106 GCTGACTTGCAGAATGTACACGG + Intronic
1059591993 9:115671849-115671871 TCTGATAGGCTGGATGTGGAAGG + Intergenic
1059993291 9:119885419-119885441 TCTCATTTGTAGAATGAGGGGGG - Intergenic
1061129966 9:128703132-128703154 ACTGATTTGGAGACTGTGCAAGG - Intronic
1186402182 X:9270201-9270223 TCTGATTTTCAAAATATGAAAGG + Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1188310525 X:28611610-28611632 TCTGATTTACAGAATGGAAATGG - Intronic
1189030348 X:37443025-37443047 GCTGCTTTGAAGAATGTAGAGGG + Intronic
1189035948 X:37493483-37493505 TCTGCTCTGAAGAATGTAGAGGG + Intronic
1189037468 X:37507033-37507055 ACTGCTTTGAAGAATGTAGAGGG + Intronic
1189695579 X:43658204-43658226 TCTGAATTGCAGAATACAGATGG - Intronic
1189874593 X:45422524-45422546 TCTGATATCCAGAATGTATAAGG + Intergenic
1190002552 X:46703144-46703166 TCTAATTTCCAGAATCTGTAAGG - Intronic
1190927095 X:54920348-54920370 TCTGAATTGCATAAGATGGACGG + Intergenic
1192631695 X:72782325-72782347 TCTGTCTTTCAGAATGTGAAAGG - Intronic
1192634998 X:72807883-72807905 TCTGTCTTTCAGAATGTGAAAGG - Intronic
1192646717 X:72912920-72912942 TCTGTCTTTCAGAATGTGAAAGG + Intronic
1192650014 X:72938476-72938498 TCTGTCTTTCAGAATGTGAAAGG + Intronic
1193041389 X:77007380-77007402 TCTGCATTACAAAATGTGGAGGG + Intergenic
1193746720 X:85290819-85290841 TCTAATATGCAGAATCTGTAAGG - Intronic
1193931491 X:87558285-87558307 TCTCATTTGTAAAATGAGGACGG + Intronic
1195488150 X:105434591-105434613 TCTAATATCCAGAATTTGGAAGG - Intronic
1196132442 X:112171972-112171994 TCTGATATCCAGAGTGTAGAAGG + Intergenic
1196294322 X:113981031-113981053 TATGAATTGCAAAATTTGGAGGG + Intergenic
1197986408 X:132270437-132270459 TCTGATTTGCTAAATCTGGTAGG - Intergenic
1199902961 X:152195615-152195637 TCGGATTTGAAGAAAGAGGAAGG - Intronic
1201513241 Y:14788506-14788528 TGTGCTTTGAAGAATGAGGAAGG - Intronic