ID: 1058869499

View in Genome Browser
Species Human (GRCh38)
Location 9:109190194-109190216
Sequence CTGAGGCCCCACCACTATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 217}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058869499_1058869502 -6 Left 1058869499 9:109190194-109190216 CCAGGATAGTGGTGGGGCCTCAG 0: 1
1: 0
2: 1
3: 16
4: 217
Right 1058869502 9:109190211-109190233 CCTCAGGAGTCTCATCCAGTAGG No data
1058869499_1058869510 27 Left 1058869499 9:109190194-109190216 CCAGGATAGTGGTGGGGCCTCAG 0: 1
1: 0
2: 1
3: 16
4: 217
Right 1058869510 9:109190244-109190266 CTAGAGATAGGCTGTAAGCTTGG No data
1058869499_1058869507 4 Left 1058869499 9:109190194-109190216 CCAGGATAGTGGTGGGGCCTCAG 0: 1
1: 0
2: 1
3: 16
4: 217
Right 1058869507 9:109190221-109190243 CTCATCCAGTAGGAGGCAGGGGG No data
1058869499_1058869505 2 Left 1058869499 9:109190194-109190216 CCAGGATAGTGGTGGGGCCTCAG 0: 1
1: 0
2: 1
3: 16
4: 217
Right 1058869505 9:109190219-109190241 GTCTCATCCAGTAGGAGGCAGGG No data
1058869499_1058869511 28 Left 1058869499 9:109190194-109190216 CCAGGATAGTGGTGGGGCCTCAG 0: 1
1: 0
2: 1
3: 16
4: 217
Right 1058869511 9:109190245-109190267 TAGAGATAGGCTGTAAGCTTGGG No data
1058869499_1058869503 -3 Left 1058869499 9:109190194-109190216 CCAGGATAGTGGTGGGGCCTCAG 0: 1
1: 0
2: 1
3: 16
4: 217
Right 1058869503 9:109190214-109190236 CAGGAGTCTCATCCAGTAGGAGG No data
1058869499_1058869506 3 Left 1058869499 9:109190194-109190216 CCAGGATAGTGGTGGGGCCTCAG 0: 1
1: 0
2: 1
3: 16
4: 217
Right 1058869506 9:109190220-109190242 TCTCATCCAGTAGGAGGCAGGGG No data
1058869499_1058869504 1 Left 1058869499 9:109190194-109190216 CCAGGATAGTGGTGGGGCCTCAG 0: 1
1: 0
2: 1
3: 16
4: 217
Right 1058869504 9:109190218-109190240 AGTCTCATCCAGTAGGAGGCAGG No data
1058869499_1058869509 15 Left 1058869499 9:109190194-109190216 CCAGGATAGTGGTGGGGCCTCAG 0: 1
1: 0
2: 1
3: 16
4: 217
Right 1058869509 9:109190232-109190254 GGAGGCAGGGGGCTAGAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058869499 Original CRISPR CTGAGGCCCCACCACTATCC TGG (reversed) Intronic
902037512 1:13468293-13468315 CTGAGGGCCCACCCTTACCCTGG - Intergenic
902514706 1:16983877-16983899 CTGAGGGCCCACCTCTCTCCAGG - Intergenic
903494561 1:23756803-23756825 CTGAGCCACCACCAGAATCCAGG + Intronic
903674511 1:25055588-25055610 CTGAGCCCCCACCACCACCGGGG + Intergenic
904784686 1:32974844-32974866 CTGACCCCCCACCTCTCTCCCGG + Intergenic
906941060 1:50255807-50255829 CTGAGGCCACACACCTACCCTGG - Intergenic
907140674 1:52182114-52182136 CTGACCCCCCACCTCTCTCCTGG - Intronic
907584393 1:55603859-55603881 CTGAGGCCTCAGCAATTTCCTGG - Intergenic
908724774 1:67163765-67163787 CTGAGGCCTCACCAGAAGCCAGG + Intronic
912159626 1:106966051-106966073 ATGAGGGCCCACCATTTTCCAGG - Intergenic
912632324 1:111256491-111256513 CAGAGTACCCACCTCTATCCTGG + Intergenic
912681508 1:111732090-111732112 CTCCTGCCCCACCACTGTCCTGG - Intronic
915184768 1:154096092-154096114 CCGAGGCCCCACCCCTTTACAGG + Intronic
915342917 1:155185979-155186001 CAGAGGCCCCACCAATTTCTCGG - Intronic
916075159 1:161196391-161196413 CTGAGGACCCAGCACTGTCAGGG + Intronic
917304662 1:173613493-173613515 CTGAGCCCCCACCTCCCTCCCGG - Intronic
918047115 1:180948184-180948206 CGGAGGCCCCAGCACTCGCCAGG - Exonic
921157526 1:212450061-212450083 CCCAGGCCCCAGCCCTATCCTGG + Intergenic
924130602 1:240903680-240903702 ATTAGGCCCCACCACCATCATGG - Intronic
1066067659 10:31773892-31773914 CTGAGGCCCCACAACCACCGTGG - Intergenic
1067697465 10:48546222-48546244 CTGTGCCCCCACCCCTACCCTGG - Intronic
1070786825 10:79166804-79166826 CAGAGGCCCCACCACTCACCTGG + Intronic
1071809546 10:89164506-89164528 ATGAGGTCCCAGCACTGTCCTGG - Intergenic
1072772472 10:98152933-98152955 CTGACCCCCCACCTCTCTCCCGG - Intronic
1073976927 10:109112608-109112630 CTGAGGCCCCCCTATTATCTAGG + Intergenic
1073997273 10:109329896-109329918 CAATGGCCCCACCACCATCCAGG + Intergenic
1076787695 10:132759266-132759288 CTGAGGACCCCTCACTACCCCGG - Intronic
1077394465 11:2314389-2314411 CTGAGGCACCACAAGTATCCAGG - Intronic
1077541127 11:3147026-3147048 CCGAGGCCCCAGCTCTGTCCTGG + Intronic
1078567416 11:12428436-12428458 CTCAGGCCCCAGCCCTGTCCTGG - Intronic
1080875906 11:36274102-36274124 CTGAGCCCCCTCCACCATACTGG - Exonic
1083403496 11:62440766-62440788 CTGAGGGCCCTCAACTGTCCTGG - Intronic
1083927726 11:65818594-65818616 CTTAGGCCCCAGCAAAATCCAGG + Intergenic
1083939961 11:65890540-65890562 CTCAGGCCCCGCCCCTTTCCGGG + Exonic
1084148819 11:67278686-67278708 CTGAGGCCACACCACTCCTCTGG - Intronic
1085702643 11:78758642-78758664 CTGAGGCCACACCACTAGCAAGG - Intronic
1085958130 11:81426407-81426429 CTGAGGGCTTACCACTATCAAGG - Intergenic
1086881714 11:92158225-92158247 CTGACGCCCCACCTCGCTCCCGG - Intergenic
1087604018 11:100352924-100352946 CTGAGGCCTCATCACGTTCCTGG + Intronic
1088259139 11:107928375-107928397 CAGAGGCCCCGCCCCTAGCCGGG + Intergenic
1088472325 11:110199489-110199511 ATGAGGTCCCACCAGCATCCTGG + Intronic
1089218952 11:116854686-116854708 CTGTGCCCCCACCACTCTGCAGG - Intronic
1101608755 12:106270972-106270994 CTGAAGCCCCACCATCACCCAGG + Intronic
1101885240 12:108656276-108656298 CTGAGCCCCCACCTCCCTCCCGG - Intronic
1103618526 12:122171183-122171205 GTGAGGCCCAACCACTGCCCGGG + Intronic
1104019213 12:124980544-124980566 CTGCAGCCCCACCACTGCCCAGG - Exonic
1104372152 12:128232919-128232941 CTTAGGCCCCACCACCTTCAGGG - Intergenic
1105717537 13:23082149-23082171 CTGAGCCCCCGCCATTCTCCTGG + Intergenic
1106043343 13:26114990-26115012 CTGAGGCCTCATCACCAGCCAGG + Intergenic
1109430700 13:62230190-62230212 CTCAGGTCCCACCACAATCAAGG - Intergenic
1112505839 13:99975145-99975167 CTGAGGCTCCACCGCTCCCCCGG + Intergenic
1113537463 13:111079565-111079587 CTGAGACCCCACCAGTCCCCCGG + Intergenic
1113973416 13:114208030-114208052 CTGAGGTCCCACCAAGAGCCTGG - Intergenic
1114546530 14:23506718-23506740 CTGATGTCCCAGCACTGTCCTGG + Intronic
1115814965 14:37153648-37153670 CTGAGGCCCCACCACTGGAGAGG - Intronic
1117498595 14:56330245-56330267 CTGAGCCCACACCACTTTCAGGG + Intergenic
1118059058 14:62115969-62115991 CAGCGGCCCCACCACTCTCAGGG - Intergenic
1118338696 14:64877640-64877662 CTGAGGTTCCACTACCATCCAGG + Intronic
1120717974 14:87860618-87860640 CTGAGGCCTCACCAGAAGCCAGG - Intronic
1121309937 14:92930176-92930198 CTGAGGCCCCACCACTTCCCAGG - Intronic
1122257821 14:100492064-100492086 CTGAGCCCCCACCAGAAACCAGG + Intronic
1122711768 14:103663692-103663714 CTGAGAGCCCACCACTCCCCCGG - Intronic
1122782486 14:104149546-104149568 GGGAGGCCCCAGCCCTATCCAGG - Intronic
1122790593 14:104182691-104182713 CTCAGACCCCAGCACTGTCCTGG - Intergenic
1122874856 14:104659322-104659344 CAGTGGCCCCACCAGAATCCAGG - Intergenic
1125129174 15:36261048-36261070 GTGAGGCACTACCACTATCTTGG + Intergenic
1126145165 15:45466906-45466928 CTGTGACCCCACACCTATCCAGG - Intergenic
1126295597 15:47133052-47133074 CTGACCCCCCACCTCCATCCCGG - Intergenic
1127584733 15:60367677-60367699 CTGACCCCCCACCACCCTCCCGG - Intronic
1128229055 15:66022200-66022222 CTGAGGGCCCACACCTGTCCTGG - Intronic
1132603689 16:784872-784894 CTGAGGCCCCAGCAGGACCCAGG - Intergenic
1132894734 16:2223451-2223473 TTAAGGCCACACCGCTATCCAGG + Intergenic
1133074746 16:3271476-3271498 CTGACCCCCCACCTCTCTCCCGG + Intronic
1138126597 16:54443859-54443881 CTGAGGCTTCACCAATCTCCTGG + Intergenic
1139547524 16:67656658-67656680 CTGATTCCCCACCCCAATCCTGG + Intronic
1139633544 16:68244918-68244940 CTGAGGCCCAAGAACTGTCCGGG + Intergenic
1141198894 16:81882388-81882410 ATGAGGCCCCACCAGACTCCAGG - Intronic
1141842979 16:86586253-86586275 CCGAGGCTCCACCCCTCTCCTGG + Intergenic
1142004963 16:87685327-87685349 CTGCGTCCCCTCCACTCTCCTGG + Intronic
1142719107 17:1764401-1764423 CAGAGGCCTCACCACCATCCAGG - Intronic
1143298115 17:5886501-5886523 CTGAGGGGCCATCACCATCCTGG - Intronic
1144007605 17:11115213-11115235 CTGAGGCACCAGCACCAGCCAGG + Intergenic
1144392911 17:14812717-14812739 CTGAAACCTCACCACTATCATGG - Intergenic
1144772150 17:17765887-17765909 CTGAAGCCCCACCATTCTCCTGG - Intronic
1147385230 17:40077170-40077192 CTGAGGCCCTACCAGAATCAGGG + Intronic
1148052015 17:44774222-44774244 CCAAGGCCCCACCACCACCCGGG + Intronic
1148156406 17:45427405-45427427 CTGAGGCACAGCCACGATCCTGG - Intronic
1150132941 17:62679105-62679127 CTGAGACACCACCTCTGTCCTGG + Intronic
1150152468 17:62821738-62821760 CTGTGCCCCCACCACCACCCAGG - Intergenic
1151756754 17:76079623-76079645 AGGAGACCCCAGCACTATCCAGG - Intronic
1152609345 17:81307998-81308020 CTGTGTCTCCACCACGATCCGGG + Intergenic
1152624266 17:81381074-81381096 CTGAGGCCACACCGGTGTCCGGG - Intergenic
1153617975 18:6951730-6951752 CTGAGTCCCCACCGCCACCCTGG - Intronic
1155491736 18:26406876-26406898 CTCAGGACTCTCCACTATCCAGG - Intergenic
1157516757 18:48316692-48316714 CTGAGGCCTCACCATAAGCCAGG + Intronic
1157685202 18:49637765-49637787 CTGAGGCCCCACCAAAAGTCAGG + Intergenic
1157752614 18:50193362-50193384 CTGCGGCCCCACCCCCAGCCAGG + Intronic
1160262814 18:77311037-77311059 CTGAGGCCCCAATACCCTCCTGG + Intergenic
1160698768 19:496676-496698 CTGAGCCCCCTCCCCTCTCCTGG - Intronic
1160993740 19:1872425-1872447 CTGAAACCCCACCACTAGGCTGG - Intergenic
1162786580 19:13038786-13038808 CTGCGCCACCACCACCATCCTGG - Intronic
1163007500 19:14406046-14406068 ATGAGGCCCCGCCCCTGTCCGGG + Intronic
1163851961 19:19669208-19669230 CTGAGGCCCCCGCACGATCTGGG - Intronic
1165012777 19:32860805-32860827 CCCAGGCCCCACCACTAGCAGGG - Intronic
1165105256 19:33465440-33465462 CTGAGGCCACACCCCTCTACTGG + Intronic
1166711596 19:44941187-44941209 TTGAGGCCCTACCACAAGCCTGG + Intergenic
1166753138 19:45174404-45174426 CTGAGGACCCACTACGAGCCAGG + Intronic
1166862842 19:45819678-45819700 CTGTGTCCCCAGCACTACCCAGG + Intronic
1167328719 19:48840964-48840986 CTGTCCACCCACCACTATCCAGG + Intronic
1168120886 19:54252031-54252053 GTGAGGCCCCGCCCCTGTCCCGG - Intronic
1168243032 19:55096659-55096681 CTGAGGGCCCACCAGTGCCCTGG - Intronic
927493149 2:23533667-23533689 GTGAGGACCCCCCACTCTCCCGG + Intronic
934664433 2:96159718-96159740 GAGAGACCCCACCTCTATCCTGG + Intergenic
936079825 2:109424381-109424403 CTGAAGCCCCACCACTGGACAGG - Intronic
937363926 2:121247216-121247238 CTAAGTCCCCACCACTCCCCAGG + Intronic
939678533 2:145102231-145102253 CTGAGGCCCCACCAGAAGCCAGG - Intergenic
940316940 2:152335920-152335942 CTGAGCCCCCATCCCCATCCCGG - Intronic
940643763 2:156369492-156369514 CTGACCCCCCACCACCCTCCCGG - Intergenic
941033397 2:160538704-160538726 CTCAGCCAGCACCACTATCCAGG - Intergenic
944547760 2:200814413-200814435 CTGAGTGCCCAGCACTTTCCTGG - Intronic
945957316 2:216098535-216098557 CAGAGTCCCTGCCACTATCCAGG + Intronic
947386727 2:229598185-229598207 CCCAGGCCCCACCATCATCCAGG - Intronic
948461036 2:238130124-238130146 CTGAGCTCCCACCATTGTCCTGG - Exonic
948608591 2:239152491-239152513 CAGAGGCCCCGCCCCTTTCCTGG - Intronic
948644390 2:239394716-239394738 GTGAGGCCCCACCTCTGGCCTGG - Intronic
948736322 2:240008725-240008747 CTGAAGCCCCACCAGGAGCCAGG + Intronic
1170715651 20:18828710-18828732 CTGAGTACCCGCCACCATCCAGG - Intronic
1171381581 20:24737873-24737895 CTGAGGACCCTCCTCTATCTTGG - Intergenic
1172147561 20:32767354-32767376 CTGAGACCTCACCAGTCTCCTGG - Intronic
1172483537 20:35285466-35285488 CTTGGCCCCCATCACTATCCTGG - Intergenic
1173563905 20:44025790-44025812 CTCAAGCCCCAGCTCTATCCTGG + Intronic
1173564072 20:44026862-44026884 CTGAGCACCCACAACTCTCCTGG + Intronic
1174129201 20:48329810-48329832 CTGAGGGCCCACCTCTAACCTGG - Intergenic
1175373639 20:58509902-58509924 CTGAGGCCCCACAACCCTCCAGG + Intronic
1175722949 20:61298378-61298400 CTGAGGACCCACCACTCAGCAGG + Intronic
1175895174 20:62332848-62332870 CTCAGCCCCCACCACTTGCCTGG - Intronic
1179990759 21:44947175-44947197 CTCAGGCCCCAGCACAAACCCGG - Intronic
1181507256 22:23367995-23368017 CTGAGACCCCAGAAATATCCAGG - Intergenic
1182745367 22:32601650-32601672 CTGTGTCCCCAGCACTAGCCCGG - Intronic
1183444410 22:37843847-37843869 CTGAGGCCCCGCCCCTCGCCCGG + Intronic
1184236539 22:43186207-43186229 CTGAGGCCACAGCACCTTCCCGG - Intronic
1184327229 22:43798068-43798090 CTTAGGCCCCACCCCAACCCAGG - Intronic
1184921709 22:47609949-47609971 TTGAGGCCCCAGCACTCCCCTGG + Intergenic
1185186478 22:49403990-49404012 GGGAGGTCCCACCTCTATCCAGG - Intergenic
1185415979 22:50710475-50710497 CTGTGGCCCCAGCACATTCCTGG - Intergenic
950126971 3:10515597-10515619 CTGAGGTCCCAGAACTACCCGGG + Intronic
953932089 3:47010495-47010517 CACAGGCCCATCCACTATCCAGG + Intergenic
954972257 3:54661129-54661151 CTGAGGCCCCACCAGAACCCTGG + Intronic
956074964 3:65495507-65495529 CTGAGGCCCCAACACATGCCAGG + Intronic
956410510 3:68973839-68973861 CTAAGGCCCCACCCCTCTCTGGG + Intergenic
960232220 3:115242088-115242110 CTGTGGCAGCAGCACTATCCAGG - Intergenic
962740608 3:138360499-138360521 CTGAGACCCCACCAGCACCCAGG - Intronic
962846286 3:139276571-139276593 TTGAGGCCCCAGCATTATGCAGG - Intronic
963322313 3:143822293-143822315 CTGAGGGTCCACCACTTTTCTGG + Intronic
966351806 3:179038996-179039018 CTGAGGCCCCTCCCCCAGCCAGG - Intronic
966882170 3:184356694-184356716 CTGAGGCTCAAACACTCTCCAGG + Intronic
969288777 4:6225338-6225360 CAGAGGCCCCACAACTCTCTGGG - Intergenic
969602222 4:8183075-8183097 CAGAGGCCCCACCCCTTGCCAGG - Intronic
969689720 4:8697875-8697897 CTGGGTCCCCACCACTGCCCTGG + Intergenic
970529555 4:16967984-16968006 CTGAGTCCCCACTTCTTTCCCGG - Intergenic
970804055 4:20009176-20009198 ATGAGGCACCTCCAGTATCCAGG - Intergenic
971358283 4:25914087-25914109 CTGTGACCCCACCCCTTTCCTGG + Intronic
972730524 4:41790215-41790237 CTGAGGCCTTACCAGAATCCAGG - Intergenic
973898052 4:55436024-55436046 CTCAGGGCCCACCACGCTCCTGG - Intronic
975241748 4:72067327-72067349 CTGAGGCCCCACAGCCACCCTGG + Intronic
978448402 4:108802862-108802884 CTGAGGACTCTCCACTATCCTGG - Intergenic
979593523 4:122507067-122507089 CTGATGCCCCTCCACTAACAAGG - Intergenic
983490647 4:168385335-168385357 CTGAGGGCACACCACCCTCCAGG - Intronic
983571592 4:169214311-169214333 CTGAGGCCTCACCAGAAGCCAGG + Intronic
984803539 4:183735369-183735391 CTGACCCCCCACCACCCTCCCGG + Intergenic
984820390 4:183876597-183876619 CTGAGGCCCCACCTGTATGGAGG + Intronic
985199556 4:187470774-187470796 CTGAGGCCTCACCAGAAGCCAGG + Intergenic
990746326 5:58962759-58962781 CTGAGGCCTCACCAGAAGCCAGG + Intergenic
991136831 5:63192428-63192450 CTGAGGCCTCACCAGAAGCCAGG - Intergenic
992753965 5:79886951-79886973 CTGAGGCCAAAGCACTATTCAGG - Intergenic
997414461 5:133714379-133714401 CTGGGGCTACACCACTGTCCAGG - Intergenic
1000079059 5:157827468-157827490 CAGAAATCCCACCACTATCCTGG - Intronic
1000878613 5:166670577-166670599 GTGAGGCCACACCACTAAGCTGG + Intergenic
1002213438 5:177611659-177611681 CTGGGCCTCCACCACTCTCCAGG + Intergenic
1003023266 6:2530448-2530470 CTCAGCCAGCACCACTATCCAGG + Intergenic
1003456939 6:6292045-6292067 TTGAGGTCCCAGCACTTTCCAGG + Intronic
1004613946 6:17271998-17272020 CTGAGGCCTCACCAGAAGCCAGG - Intergenic
1005157249 6:22820598-22820620 CTGAGCTCCCACCGCTATCCTGG + Intergenic
1007979480 6:46136598-46136620 TTGAAGCCCCTCCAATATCCAGG - Intronic
1010264404 6:73851150-73851172 CTGACCCCCCACCTCTCTCCCGG + Intergenic
1014467312 6:121772446-121772468 CTGAATCCACACAACTATCCTGG + Intergenic
1015202068 6:130593902-130593924 CTGAGCCCTCCCCACCATCCAGG + Intergenic
1016990080 6:149922681-149922703 CTCTGGCCCCTCCACTCTCCGGG + Intronic
1019280615 7:198003-198025 CGGAGGCCACACCAGAATCCTGG - Intronic
1019564616 7:1673261-1673283 CTCCGGCCCCACCCCAATCCGGG - Intergenic
1019766819 7:2857652-2857674 CTGAGGCCCTGCAATTATCCAGG - Intergenic
1023668922 7:42555611-42555633 ATGAGGCCCACCCACTATCGGGG - Intergenic
1023892001 7:44399495-44399517 CTGAGTCCCCACAACTTTCCTGG - Intronic
1024142991 7:46480789-46480811 CTGTGGCCCCACCTCCACCCAGG - Intergenic
1025613212 7:63096257-63096279 CTGGAGCCCCACCGCTTTCCTGG - Intergenic
1025979126 7:66393361-66393383 CTGACCCCCCACCACCCTCCCGG + Intronic
1029972434 7:104802376-104802398 CTCAGCCCCCACCAGTATCTGGG - Intronic
1033070659 7:138198491-138198513 CTCAGTCCCCAACACTTTCCAGG + Intergenic
1036202484 8:6780853-6780875 CTGAGGCCTCACCAGAAGCCAGG - Intergenic
1036654543 8:10669572-10669594 CTGAGTCCCAGCCACCATCCAGG + Intronic
1037355325 8:18013215-18013237 CTGAGGTCCCACCGTTATACAGG + Intronic
1038037123 8:23696032-23696054 ATGGGGCCCCTCCACTATGCTGG + Intergenic
1047180562 8:122583954-122583976 CTGAGCCCCCAACACTAGGCTGG - Intergenic
1047493479 8:125392537-125392559 CTGAGGTCCCACCGCTCTCTGGG - Intergenic
1048731170 8:137442287-137442309 CAAAGGCCCCACCACAAGCCTGG - Intergenic
1049395455 8:142398161-142398183 CTCAGGCCTCACCAGCATCCAGG + Intronic
1049636283 8:143691278-143691300 GGGAGGCCCCACTACTGTCCTGG - Intronic
1052858788 9:33423776-33423798 CTGACCCCCCACCACCCTCCCGG - Intergenic
1053346730 9:37383613-37383635 CAGGGGCCCCGCCACTCTCCTGG + Intergenic
1055960871 9:81819009-81819031 GTGAATCCTCACCACTATCCTGG - Intergenic
1057260177 9:93578462-93578484 CAGAGGCCCCACCACTTTCAGGG - Intronic
1057426151 9:94951346-94951368 CTGGGGCCCCCCCAAGATCCAGG - Intronic
1058142613 9:101373755-101373777 CTGAGGACTCAGCACTATCTTGG + Intronic
1058869499 9:109190194-109190216 CTGAGGCCCCACCACTATCCTGG - Intronic
1059092278 9:111372410-111372432 CTCAGGCCACACTACTAACCAGG + Exonic
1059472040 9:114512756-114512778 CTGAGGGCCCACCTTTTTCCTGG + Intergenic
1060884131 9:127138694-127138716 CTGAGGTCACACAACTACCCAGG - Intronic
1061892787 9:133631527-133631549 CTCAGGACCCACCACCATCCTGG + Intergenic
1062400785 9:136371743-136371765 CTGAGGCCCAACCTCAACCCTGG - Intronic
1062442168 9:136575733-136575755 CTGAGGCCGCACCACCAGCGGGG + Intergenic
1062703373 9:137919785-137919807 CTGAGACCCCATCACTCACCCGG - Intronic
1186697780 X:12055510-12055532 CTGAGGCCTCACCAGAAGCCAGG + Intergenic
1186820300 X:13281323-13281345 TTGAAGCCCCACGACTCTCCAGG + Intergenic
1187245004 X:17546101-17546123 CTGAGACACCAGCACTAGCCAGG - Intronic
1187263553 X:17709738-17709760 CTGAGGCACCAGCACCAGCCAGG - Intronic
1196001882 X:110795561-110795583 CTTGGGCCCCACCTCCATCCAGG + Intronic
1199606658 X:149584260-149584282 CTGAGGTCCCTCCTTTATCCTGG - Intronic
1199632465 X:149785108-149785130 CTGAGGTCCCTCCTTTATCCTGG + Intronic
1199733959 X:150666945-150666967 CTGAGCTCCCACCACCATGCTGG + Intronic
1199952367 X:152716179-152716201 CTGAAGTCCCTCCATTATCCTGG + Intronic
1199954997 X:152735370-152735392 CTGAGGTCCCTCCATTATCCTGG + Intronic
1199957316 X:152752269-152752291 CTGAAGTCCCTCCATTATCCTGG - Intronic
1199993265 X:153002092-153002114 CTGAGACCCCATCACTCTCTTGG - Intergenic
1200079017 X:153566387-153566409 CTGAGGCCACACCCCTTCCCAGG + Intronic
1200761636 Y:7044333-7044355 CTGTGGCCCCAGCACTATGGAGG - Intronic