ID: 1058869894

View in Genome Browser
Species Human (GRCh38)
Location 9:109192447-109192469
Sequence TGCTAATGAGATCAGTGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058869894 Original CRISPR TGCTAATGAGATCAGTGTAG AGG (reversed) Intronic
900718337 1:4159309-4159331 TCCTCCTGAGATCAGTGCAGGGG - Intergenic
901322221 1:8346702-8346724 TGGTCATGAGCTCAGTGAAGCGG + Intergenic
904378242 1:30095083-30095105 TGCAAATGAGATCAGTGTCCTGG - Intergenic
908069607 1:60443884-60443906 TGCTAATGATATCACTGAATAGG + Intergenic
909256825 1:73434803-73434825 TGCTAATGAGATTTGGGTATAGG - Intergenic
909816761 1:80004172-80004194 TCATCATGAGATCATTGTAGGGG + Intergenic
909984037 1:82138696-82138718 TGCTCATGAGATGATTGTTGAGG + Intergenic
914049229 1:144117888-144117910 TGCTATTGTGAACAGTGTGGAGG - Intergenic
914129955 1:144847557-144847579 TGCTATTGTGAACAGTGTGGAGG + Intergenic
922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG + Intronic
922849010 1:228716063-228716085 TGTTAATGAGCTGAGTGTGGTGG - Intergenic
923732717 1:236568215-236568237 TGCTAAAGAGTTCAGAATAGGGG - Intronic
1063996950 10:11628586-11628608 TAATAATGAGATAAGTGGAGGGG - Intergenic
1064457246 10:15499328-15499350 TGCTAAAGATATCTGTGTAAAGG + Intergenic
1065960920 10:30733535-30733557 TGCAAATTAGCTGAGTGTAGTGG - Intergenic
1070174700 10:73960108-73960130 TGCTCAGAAGGTCAGTGTAGAGG - Intergenic
1072878113 10:99196055-99196077 TGAAAATGAGTTCACTGTAGAGG - Intronic
1075885200 10:125894221-125894243 TGCTAATGAGATAGGGGTGGGGG - Intronic
1080516225 11:33023417-33023439 TACAAGTGAAATCAGTGTAGTGG + Intronic
1080640176 11:34154132-34154154 TGCTTCTGAGGGCAGTGTAGAGG - Intronic
1088749191 11:112829596-112829618 TTCCAATGAGTTCAGTGTCGTGG + Intergenic
1091779833 12:3206895-3206917 TGCTGATTAGATCAGACTAGAGG + Intronic
1094384018 12:29874031-29874053 TGCTAAAGAAACAAGTGTAGGGG - Intergenic
1099078221 12:78139346-78139368 TGCTACTGAGATCAATATGGTGG - Intronic
1099657116 12:85507716-85507738 TGTTAATGAGCTCAGTGTGCTGG + Intergenic
1099899403 12:88689508-88689530 TGCTAATCAAATGAGTGAAGAGG - Intergenic
1101179891 12:102204563-102204585 TGGTAATGGGATCAGTGAAGTGG + Intergenic
1105741810 13:23333045-23333067 TGCTAAGGAAATCAGTGTGAGGG - Exonic
1106441315 13:29774950-29774972 GGCTAATGAGATCAGAACAGGGG + Intronic
1107726773 13:43307165-43307187 TGGTAATGAGAACAGTGGGGAGG - Intronic
1108522273 13:51257255-51257277 TGCTATGGAGAACAGTGTGGTGG - Intronic
1108542907 13:51460966-51460988 TGATAAGGGGATCAGTGTAGCGG - Intergenic
1109568616 13:64154728-64154750 TGCTAATTAGATAAATGTTGTGG - Intergenic
1111671043 13:91330747-91330769 AGCCATAGAGATCAGTGTAGGGG - Intergenic
1112397088 13:99043217-99043239 TCCTACTGAGGTCACTGTAGGGG - Intronic
1112779777 13:102886845-102886867 TGCTACTGAGATCACGGAAGGGG - Intergenic
1113228474 13:108184998-108185020 TGTAAATGAGGTCACTGTAGAGG - Intergenic
1113271495 13:108679613-108679635 AGATAATGTGATCAGTTTAGGGG - Intronic
1117803594 14:59468098-59468120 TTCTAATTAGGCCAGTGTAGTGG + Intronic
1118848271 14:69564802-69564824 TGCTGATGGGCTCACTGTAGGGG - Intergenic
1122183960 14:99975125-99975147 GGCGAATGAGACCAGTGCAGTGG - Intronic
1202872849 14_GL000225v1_random:179709-179731 TGCTAATGAGATAGGGGTGGGGG + Intergenic
1123419165 15:20117456-20117478 TGCTATTGTGAACAGTGTGGAGG - Intergenic
1123446696 15:20336044-20336066 TGCTATTGTGAACAGTGTGGAGG + Intergenic
1123528386 15:21123999-21124021 TGCTATTGTGAACAGTGTGGAGG - Intergenic
1125177269 15:36838691-36838713 TGCTAATGAAATCCCTGTGGTGG - Intergenic
1126983802 15:54278587-54278609 TACTGAAGAGATCAGTGTCGGGG - Intronic
1133503275 16:6385857-6385879 TGCCAATGAGATCTTTGTATGGG + Intronic
1135051683 16:19198244-19198266 TACTACTGAGATCAGTGTTGTGG - Intronic
1141346165 16:83248093-83248115 TGCTAATGAGATCAGAGACAGGG + Intronic
1203137979 16_KI270728v1_random:1741579-1741601 TGCTATTGTGAACAGTGTGGAGG + Intergenic
1144084138 17:11793366-11793388 TGCTAAACAGATCATTCTAGTGG - Intronic
1144166829 17:12620341-12620363 TGCTAATGAGATCTGGGTATAGG - Intergenic
1155673400 18:28399593-28399615 TGATAATGACATCTGTGTAGAGG + Intergenic
1155896077 18:31328553-31328575 TGCCAATGAGGACAGTATAGAGG - Intronic
1159309472 18:66688231-66688253 TAGAAATGAGATCAGTGTAAGGG + Intergenic
1164773104 19:30827836-30827858 TGCTAATGAGATCAAGGTCTTGG - Intergenic
1166650299 19:44568887-44568909 TACAAATTAGATGAGTGTAGTGG + Intergenic
1202688677 1_KI270712v1_random:70782-70804 TGCTATTGTGAACAGTGTGGAGG - Intergenic
925249337 2:2418443-2418465 ATCTAATGAGATCACTATAGAGG - Intergenic
928477574 2:31645995-31646017 TGCAAGTGATTTCAGTGTAGTGG - Intergenic
928687428 2:33763204-33763226 TGCGAGGGAGATCAGTGTATAGG + Intergenic
929487939 2:42371436-42371458 TGCTAATGAGTTCAGACTACAGG + Intronic
933957751 2:87385303-87385325 TGCTATTGTGAACAGTGTGGAGG + Intergenic
934241872 2:90277220-90277242 TGCTATTGTGAACAGTGTGGAGG + Intergenic
934271300 2:91539468-91539490 TGCTATTGTGAACAGTGTGGAGG - Intergenic
935252127 2:101272932-101272954 TGCTACTGAGGTCAGACTAGTGG + Intronic
936622379 2:114113749-114113771 GGCTAATGGAATCAGTGTTGTGG + Intergenic
937265870 2:120614364-120614386 TGCGGATGAGTTCAGGGTAGAGG + Intergenic
938178641 2:129160281-129160303 TTCTAATGAGATCTGTGAGGGGG - Intergenic
939673586 2:145043743-145043765 TCCTCCTGAGATCAGTCTAGAGG - Intergenic
939901801 2:147859455-147859477 GGCTTATAAAATCAGTGTAGAGG + Intronic
940949697 2:159659449-159659471 TGGAAATGAGATCTGTATAGGGG - Intergenic
942846854 2:180437279-180437301 TGCTAATGAGAGAAGTCTGGAGG + Intergenic
947049250 2:226023684-226023706 ACCTAACAAGATCAGTGTAGTGG - Intergenic
947128429 2:226896364-226896386 TGCTGATGGACTCAGTGTAGAGG - Intronic
947603501 2:231468774-231468796 AGCTGAGGAGATCACTGTAGTGG - Intronic
1171331583 20:24343874-24343896 TGCTAATGAGCTCAGTGATCAGG - Intergenic
1172508227 20:35479894-35479916 TGCTCATGAGGTCAGGGGAGAGG + Intronic
1173352707 20:42259897-42259919 TGCTAATGAGACCAAGGTAATGG - Intronic
1176898526 21:14412921-14412943 TGTTAATGAGATCAGGGAGGTGG + Intergenic
1177012836 21:15749968-15749990 TGCTAATCAGATGAGTGGCGTGG + Intronic
1177508731 21:22053818-22053840 TGATAAGGAGATTAGTGTGGGGG - Intergenic
1179607243 21:42524852-42524874 TGCTAATGAGGTGACTGTGGCGG + Intronic
1180285251 22:10739788-10739810 TGCTAATGAGATAGGGGTGGGGG - Intergenic
1180552799 22:16554136-16554158 TGCTATTGTGAACAGTGTGGAGG + Intergenic
1181351288 22:22260223-22260245 TGCTATTGTGAACAGTGTGGAGG - Intergenic
1182150609 22:28024598-28024620 TGGTAATGGGATCAGTGTGAGGG + Intronic
949860120 3:8497736-8497758 GGATCATGAGGTCAGTGTAGTGG - Intergenic
955407051 3:58632169-58632191 TGCTCATGAGCTCATTTTAGAGG + Intergenic
955470043 3:59277176-59277198 AGCTAATGAGATGACAGTAGAGG + Intergenic
958589056 3:96130469-96130491 CACTAAAGAGAACAGTGTAGAGG + Intergenic
961555855 3:127696296-127696318 TGCTAGAGAGATCAGGGCAGTGG - Intronic
964364638 3:155936489-155936511 TGGCAATGAGATCCCTGTAGAGG + Exonic
967041689 3:185699100-185699122 TGCTCATGAGGCCAGTGTGGTGG - Intronic
969600772 4:8174876-8174898 TGGCAATGAGATCCCTGTAGAGG + Intergenic
969974106 4:11080608-11080630 TTCTAATGCCATCACTGTAGGGG - Intergenic
971191187 4:24430569-24430591 TGCTCATGAGATCATTTTAGGGG - Intergenic
974388010 4:61228356-61228378 TGCTACTGAGATCACTGAAATGG - Intronic
978974715 4:114855566-114855588 TGAAAATGAGTTCACTGTAGAGG + Intronic
982236192 4:153253273-153253295 TGCTACTGACATTAGTGTTGTGG + Intronic
983108026 4:163714415-163714437 TGCTAATGAAATCAGTTTGGGGG + Intronic
985843479 5:2327135-2327157 TGAAAATCAGATCAGTGCAGGGG - Intergenic
987712123 5:21513884-21513906 TGCAAATGAGATGAGTGTTCAGG - Intergenic
988302284 5:29446904-29446926 TGCAAATGAGATGAGTGTTCAGG + Intergenic
989271554 5:39539564-39539586 TGATAATGAGAAAACTGTAGTGG + Intergenic
991004545 5:61814543-61814565 TGCTTTTGAGCTCAGTGTAGGGG - Intergenic
991329612 5:65479860-65479882 TGCAAATGAAGTCTGTGTAGTGG - Intronic
992771383 5:80051327-80051349 TGATAATAAAATAAGTGTAGAGG + Intronic
993113038 5:83683344-83683366 TGGTAGTGAGGGCAGTGTAGAGG + Intronic
993245717 5:85450494-85450516 TGCTGCAGAGATCACTGTAGGGG - Intergenic
994877185 5:105439206-105439228 TGCTAACGAGAACAGTCTGGAGG + Intergenic
995505510 5:112856036-112856058 TGCTAATGTAATCATTGTTGTGG + Intronic
996603762 5:125296714-125296736 TACTAATGAGACCAGTGTGGAGG + Intergenic
998052271 5:139045826-139045848 TGCTTATGATTTCAGTGTAGAGG - Intronic
999811844 5:155134968-155134990 TGCTATTGTGAACAGTGTTGTGG + Intergenic
1004662127 6:17719915-17719937 TGCTAACCAGATCAGTGTACTGG + Intergenic
1005088942 6:22036177-22036199 TGCTTATGAGAAAAATGTAGAGG - Intergenic
1009005583 6:57782811-57782833 TGCAAATGAGATGAGTGTTCAGG + Intergenic
1019098134 6:169603639-169603661 GTCTAATGAGCTCAGTGAAGAGG + Intronic
1019835289 7:3377489-3377511 TGCTTATGATAGCAGTGTGGGGG - Intronic
1019850606 7:3552714-3552736 TGCTAATTAGGTCATTCTAGGGG + Intronic
1021636025 7:22694387-22694409 TGCTAAGGAAAACAGTGTGGTGG + Intergenic
1023690663 7:42783126-42783148 TGCAATAGAGATCAGTGTGGGGG - Intergenic
1026770866 7:73197719-73197741 TGCCAATAAAACCAGTGTAGGGG + Intergenic
1027011733 7:74751116-74751138 TGCCAATAAAACCAGTGTAGGGG + Intronic
1027076307 7:75194935-75194957 TGCCAATAAAACCAGTGTAGGGG - Intergenic
1029871278 7:103695596-103695618 AGCTAATTAGATTAGTGTAATGG + Intronic
1030194859 7:106843556-106843578 TGTTAATGAATTCAGTGTACTGG + Intergenic
1030423278 7:109337264-109337286 AGCTAATAAGATCAGTGAAGTGG - Intergenic
1039146946 8:34458189-34458211 TGCTTATGGTATCAGTGGAGGGG + Intergenic
1039913197 8:41840971-41840993 TGCTACAGAGAACAGTGTGGAGG + Intronic
1041187728 8:55318461-55318483 TGCTAATGAGAACAGAGAAGAGG - Intronic
1042862511 8:73328488-73328510 TGCTTAAGAGCTCAGTGTTGTGG + Intergenic
1043380863 8:79700631-79700653 TGGTAATGATATAGGTGTAGTGG + Intergenic
1043593441 8:81856316-81856338 TTCTTATTAGATCAGTGTGGTGG + Intergenic
1046057061 8:109091340-109091362 TGGGAATGAGAACAGTGAAGGGG + Intronic
1047633254 8:126730982-126731004 TGTTACTGAGATCAGTGGATAGG + Intergenic
1047862077 8:128978143-128978165 TTCTAGTGAGATGAATGTAGAGG - Intergenic
1050331677 9:4552309-4552331 TGGGAATGAGGTCAGTGCAGGGG + Intronic
1058601531 9:106675865-106675887 AGCTAATGACTTCAGTGGAGCGG - Intergenic
1058869894 9:109192447-109192469 TGCTAATGAGATCAGTGTAGAGG - Intronic
1203731611 Un_GL000216v2:96844-96866 TGCTAATGAGATAGGGGTGGGGG - Intergenic
1185532936 X:836131-836153 TGCTATTGTGAACAGTGTGGAGG + Intergenic
1188947246 X:36320949-36320971 TGCTATGGAGATCAGTTTGGAGG + Intronic
1190062471 X:47219863-47219885 TGCTAATGAGGGCAGAGTGGAGG + Intronic
1194757071 X:97749914-97749936 TGCCACTTAGATGAGTGTAGGGG + Intergenic
1195602322 X:106763399-106763421 TGCAATTGAGAACAGTGGAGGGG + Intronic
1200010526 X:153117142-153117164 TGCAAGTGAGATCAGTGTGAGGG - Intergenic
1200029074 X:153282780-153282802 TGCAAGTGAGATCAGTGTGAGGG + Intergenic
1201473877 Y:14360511-14360533 TGTGAATGAGATCATTGAAGTGG + Intergenic