ID: 1058870045

View in Genome Browser
Species Human (GRCh38)
Location 9:109193472-109193494
Sequence GGTTTTGGAAGTGAGTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058870041_1058870045 17 Left 1058870041 9:109193432-109193454 CCATTTTTAAGAGGAAGAAATTG 0: 1
1: 0
2: 47
3: 500
4: 3085
Right 1058870045 9:109193472-109193494 GGTTTTGGAAGTGAGTGCTGTGG No data
1058870040_1058870045 18 Left 1058870040 9:109193431-109193453 CCCATTTTTAAGAGGAAGAAATT 0: 1
1: 0
2: 34
3: 480
4: 2883
Right 1058870045 9:109193472-109193494 GGTTTTGGAAGTGAGTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058870045 Original CRISPR GGTTTTGGAAGTGAGTGCTG TGG Intronic
No off target data available for this crispr