ID: 1058870531

View in Genome Browser
Species Human (GRCh38)
Location 9:109198030-109198052
Sequence ACAGTCCTAATGATCTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058870531_1058870535 4 Left 1058870531 9:109198030-109198052 CCCCCAGAGATCATTAGGACTGT 0: 1
1: 0
2: 1
3: 8
4: 100
Right 1058870535 9:109198057-109198079 TATTTGAACTTTACTCGTTTTGG No data
1058870531_1058870536 14 Left 1058870531 9:109198030-109198052 CCCCCAGAGATCATTAGGACTGT 0: 1
1: 0
2: 1
3: 8
4: 100
Right 1058870536 9:109198067-109198089 TTACTCGTTTTGGCTTTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058870531 Original CRISPR ACAGTCCTAATGATCTCTGG GGG (reversed) Intronic
903604617 1:24566572-24566594 AAAGTTCTAATGATCTGTTGTGG - Intronic
905530471 1:38674765-38674787 AGAGTCCTCATGATCCCTGTTGG + Intergenic
909686233 1:78352266-78352288 ACAGTCATAATGATAGCTTGGGG + Intronic
917599679 1:176561655-176561677 ACAGTGCTAAAGTTTTCTGGAGG + Intronic
918994812 1:191743573-191743595 ACAGTTCCAATGATCTCTCTTGG + Intergenic
924053438 1:240100815-240100837 ACAGTCCTATTGTTTTCAGGAGG + Intronic
1065158279 10:22893505-22893527 ACACCCCTACTGATCTCTTGTGG + Intergenic
1068287771 10:54962264-54962286 ACAGTCCTGCTGCTCTCTGCTGG + Intronic
1071559884 10:86637229-86637251 ACTGTCCTAACCATCTCAGGGGG + Intergenic
1072233929 10:93437461-93437483 ACAGCCCACATGATTTCTGGAGG + Intronic
1083168711 11:60908932-60908954 AAAGTTCTTATGAGCTCTGGAGG + Intergenic
1084683766 11:70681842-70681864 ACAGTGTTCAAGATCTCTGGAGG - Intronic
1089725864 11:120479363-120479385 ACAGTCTTAATAATTTCTGATGG + Intronic
1091333407 11:134748896-134748918 ACAAACCTTGTGATCTCTGGTGG + Intergenic
1091384068 12:81069-81091 ACATTCCAAATGCTCCCTGGTGG - Intronic
1092992149 12:13913152-13913174 ACAGTACTAAAGATCTATGTGGG - Intronic
1093789058 12:23225957-23225979 ACAGTACTAGTCATCCCTGGAGG - Intergenic
1096217576 12:49806744-49806766 ACAGCCCTAAGGCTCCCTGGAGG + Intronic
1098566611 12:71944447-71944469 TCTGTCCAAATGTTCTCTGGAGG - Exonic
1101961283 12:109252212-109252234 ACATTCCCATTGGTCTCTGGTGG + Intronic
1105915853 13:24915180-24915202 AAGATCCTATTGATCTCTGGAGG - Intronic
1108503720 13:51090652-51090674 TCAGTCCTAAGTGTCTCTGGAGG + Intergenic
1112500448 13:99939115-99939137 ACAGTGCTAAATATCCCTGGGGG + Intergenic
1117760714 14:59025481-59025503 AGAGTCTTAAAGATCTTTGGAGG + Intergenic
1118074546 14:62283780-62283802 ATAGTCCAAATGCTGTCTGGGGG + Intergenic
1119086042 14:71739730-71739752 CCGGTCCTGCTGATCTCTGGAGG - Exonic
1119178409 14:72587029-72587051 ACAGTCCTAACACACTCTGGGGG - Intergenic
1120062797 14:80003941-80003963 ACAGGCCTCATGAGCTATGGGGG - Intergenic
1120561242 14:85995704-85995726 ACAGTCCTGATGATTGCTGTCGG - Intergenic
1122059781 14:99129324-99129346 ACAGGCCTCATGGTCTCAGGAGG - Intergenic
1126667502 15:51088748-51088770 ACAGTCCTAAAGATCTGTGGAGG + Intronic
1127668412 15:61171403-61171425 ACAGACCTACTGAACTCTGGGGG - Intronic
1130982183 15:88820357-88820379 ACAGTCCTCACGATCTTTGGTGG - Intronic
1133601810 16:7347036-7347058 ACAGGCCTAGTGATCTCAGCAGG + Intronic
1138831631 16:60381782-60381804 ACAGGACTAATGTTCTCTAGAGG + Intergenic
1140021588 16:71243982-71244004 AAAGTCATCATCATCTCTGGAGG - Intergenic
1140215124 16:73000938-73000960 TCAGTCCTTATGATCCCTGGTGG + Intronic
1140755627 16:78064065-78064087 ATTGTTCTAATGATCTTTGGAGG + Intronic
1141156613 16:81601488-81601510 CCAGTTCTGAAGATCTCTGGGGG + Intronic
1144776903 17:17789385-17789407 GCAGTCCTATAGATTTCTGGAGG + Intronic
1150914010 17:69417766-69417788 TCAGCCATAATGATCTCCGGAGG + Intronic
1151963747 17:77420598-77420620 ACAGTCCTTTAGATCTCAGGCGG + Intronic
1155606147 18:27608353-27608375 ACTGTTCTAATGATCTCTGTGGG + Intergenic
1158216071 18:55102127-55102149 TAATACCTAATGATCTCTGGTGG - Intergenic
1163477647 19:17536097-17536119 ACAGTCATTATCGTCTCTGGGGG + Intronic
1164481054 19:28611268-28611290 AAAGGCCTATTGAACTCTGGGGG + Intergenic
1165148514 19:33747951-33747973 ACACTTCTAATGAGTTCTGGTGG + Intronic
1165812759 19:38621849-38621871 GCTGTCCTAATGATCTCTTCTGG + Intronic
1165824147 19:38696040-38696062 ACCCTCGTAATCATCTCTGGAGG - Intronic
1166510418 19:43405037-43405059 ATAGTGCTAATGATATCTAGTGG + Intronic
931409836 2:62018940-62018962 ACAGTGCTCCTGCTCTCTGGAGG - Intronic
931698380 2:64889215-64889237 AAAGTCCTGTTGAACTCTGGGGG - Intergenic
931720392 2:65063150-65063172 TCACTCCTAATTATATCTGGTGG + Intronic
938684723 2:133727229-133727251 GCAGTCCTGATGATTTGTGGGGG - Intergenic
938780700 2:134582255-134582277 ACATTCCTTATGCTCTTTGGGGG - Intronic
941201777 2:162520525-162520547 AAAGGCATAATGATCTCTTGAGG + Intronic
943576702 2:189638815-189638837 ATAGTCAAAATGCTCTCTGGAGG - Intergenic
943961899 2:194275048-194275070 ACAAGCCTAATGCACTCTGGTGG + Intergenic
947344403 2:229175909-229175931 ACAGTCCAAATGATCTGTGATGG + Intronic
1170776863 20:19382645-19382667 CCAGTCTTAATGCCCTCTGGGGG - Intronic
1172367731 20:34363031-34363053 ACAGTCCTTATAGGCTCTGGTGG + Intergenic
1172710370 20:36917873-36917895 ACAGCCCTAAAAATCTCAGGGGG + Intronic
1179481593 21:41682024-41682046 ACTGTGCTGATGATGTCTGGGGG - Intergenic
1183649663 22:39146555-39146577 AGAGTCCTAGTCATCTCTAGTGG + Intronic
1185079823 22:48703515-48703537 ACAGTCCCAGTGAGCTCTGGTGG + Intronic
950575488 3:13829840-13829862 GAACTCCTAATGACCTCTGGGGG - Intronic
951570937 3:24062489-24062511 GCAGTCCTAATTAAATCTGGGGG + Intergenic
953189177 3:40667679-40667701 CCAGACCTACTGAACTCTGGGGG + Intergenic
957022501 3:75140957-75140979 AAAGGCCTATTGAACTCTGGGGG + Intergenic
957044389 3:75362712-75362734 AAGGTCCTATTGAACTCTGGGGG - Intergenic
958135362 3:89482689-89482711 AAAGGCCTCATGATCTCTGTTGG - Intergenic
961892843 3:130144903-130144925 AAGGGCCTAATGAACTCTGGGGG - Intergenic
962448563 3:135492069-135492091 ACAGTCGTATTAATATCTGGGGG + Intergenic
965381541 3:167995514-167995536 ACTGTTCTAATGATCTTTAGGGG + Intergenic
968016107 3:195335219-195335241 ACAGGCCTCATGGTCTCTGTTGG - Intronic
971459307 4:26877691-26877713 ACAGACCTAAATTTCTCTGGCGG + Intronic
972109711 4:35541894-35541916 ACAGTGCTAATGATCAGAGGTGG + Intergenic
972181710 4:36475023-36475045 GGAGTCTTAATGATCTTTGGAGG + Intergenic
984273648 4:177580285-177580307 ACAGTTATAATGATTTCTGTGGG + Intergenic
989100607 5:37819282-37819304 ACAGTCCTTCAGCTCTCTGGTGG - Intronic
990681819 5:58253442-58253464 ACAGTCTTAGTGATATCTTGAGG - Intergenic
995542090 5:113195551-113195573 AGAGTCCTGGTGATCTCAGGAGG - Intronic
998099292 5:139418639-139418661 AAAGTCCTAATGTTCTCTCAAGG - Intronic
998558520 5:143149221-143149243 ACGGTTCTAATTGTCTCTGGAGG + Intronic
999099924 5:149015073-149015095 ACAGTCATAATGAACTCAGAGGG - Intronic
999247026 5:150160497-150160519 ACAGTCCTAAGAATCTAGGGAGG - Intergenic
1002765011 6:231960-231982 TCAGACCAAATGATCTCTGTAGG - Intergenic
1003942049 6:11039071-11039093 ACAGACATAAAGCTCTCTGGGGG + Intronic
1006449454 6:34097747-34097769 ACAGTCCTCAGGGTCTCTGAAGG + Intronic
1007420680 6:41717358-41717380 ACAGTTCTTATAATTTCTGGGGG - Intronic
1010389092 6:75316703-75316725 AAAGTCATAATGATTTTTGGAGG - Intronic
1017410749 6:154165497-154165519 GCAGTCCTATTAATCTCAGGAGG - Intronic
1023900887 7:44477712-44477734 ACAGTGCTAATCATGTCTGCAGG + Intronic
1028472810 7:91223356-91223378 ACAGTTCTAATAAGATCTGGAGG - Intergenic
1028744990 7:94317888-94317910 GAAGTCCTGATTATCTCTGGGGG - Intergenic
1030621542 7:111796033-111796055 AAGGTCCTCATGATCTCTGCTGG + Intronic
1032817338 7:135490055-135490077 ACAATGCTAATGATTTCTAGAGG - Intronic
1033330676 7:140414580-140414602 ACACTCCAAATCATCTTTGGGGG - Intronic
1034066910 7:148145816-148145838 CCAGTCCCAATGACCCCTGGAGG + Intronic
1034111663 7:148543162-148543184 CCAGCCCTAACGCTCTCTGGAGG + Intergenic
1035833235 8:2721216-2721238 ACAGTCCTAATGAAATCTACTGG - Intergenic
1039378080 8:37057573-37057595 ACAGACTTAGTGATATCTGGAGG - Intergenic
1044176079 8:89124437-89124459 ACAGTCCAAATGACCTATGGTGG + Intergenic
1045884698 8:107081703-107081725 AAATTCCTAATAATCTTTGGAGG - Intergenic
1051551319 9:18332788-18332810 ACACTCTTACTGAACTCTGGCGG - Intergenic
1058870531 9:109198030-109198052 ACAGTCCTAATGATCTCTGGGGG - Intronic
1187559103 X:20383123-20383145 AAAGTCCTTCTGGTCTCTGGTGG + Intergenic
1188070402 X:25711433-25711455 AGAGTCCTAATGAGCTCTGTAGG + Intergenic
1199383458 X:147196853-147196875 AGAGTTCTATTGATCTCTAGAGG - Intergenic
1199470415 X:148189513-148189535 ACTGTAGTAATGATATCTGGTGG - Intergenic