ID: 1058873315

View in Genome Browser
Species Human (GRCh38)
Location 9:109220972-109220994
Sequence CCTACTTTGCAGGAGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058873306_1058873315 22 Left 1058873306 9:109220927-109220949 CCTGAGTTGGAGTGGAAAAACCT 0: 1
1: 0
2: 2
3: 11
4: 128
Right 1058873315 9:109220972-109220994 CCTACTTTGCAGGAGAAGCTTGG No data
1058873309_1058873315 2 Left 1058873309 9:109220947-109220969 CCTGGGCTCAAGTCTTAGTTCCG 0: 1
1: 0
2: 0
3: 44
4: 597
Right 1058873315 9:109220972-109220994 CCTACTTTGCAGGAGAAGCTTGG No data
1058873305_1058873315 23 Left 1058873305 9:109220926-109220948 CCCTGAGTTGGAGTGGAAAAACC 0: 1
1: 1
2: 0
3: 12
4: 136
Right 1058873315 9:109220972-109220994 CCTACTTTGCAGGAGAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058873315 Original CRISPR CCTACTTTGCAGGAGAAGCT TGG Intronic
No off target data available for this crispr