ID: 1058874277

View in Genome Browser
Species Human (GRCh38)
Location 9:109229603-109229625
Sequence CAGCTCCTCCAGAAGGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 337}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058874277_1058874285 19 Left 1058874277 9:109229603-109229625 CCACACACCTTCTGGAGGAGCTG 0: 1
1: 0
2: 3
3: 37
4: 337
Right 1058874285 9:109229645-109229667 TGTTTTACTTTAGCCTCAATGGG No data
1058874277_1058874282 -8 Left 1058874277 9:109229603-109229625 CCACACACCTTCTGGAGGAGCTG 0: 1
1: 0
2: 3
3: 37
4: 337
Right 1058874282 9:109229618-109229640 AGGAGCTGGTTGGGACAAACTGG No data
1058874277_1058874286 20 Left 1058874277 9:109229603-109229625 CCACACACCTTCTGGAGGAGCTG 0: 1
1: 0
2: 3
3: 37
4: 337
Right 1058874286 9:109229646-109229668 GTTTTACTTTAGCCTCAATGGGG No data
1058874277_1058874284 18 Left 1058874277 9:109229603-109229625 CCACACACCTTCTGGAGGAGCTG 0: 1
1: 0
2: 3
3: 37
4: 337
Right 1058874284 9:109229644-109229666 CTGTTTTACTTTAGCCTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058874277 Original CRISPR CAGCTCCTCCAGAAGGTGTG TGG (reversed) Intronic
900371846 1:2335744-2335766 CAGCTCCTCCACAGTGTGCGGGG + Intronic
900792630 1:4690202-4690224 CAGACCCTCCAGGAGGTTTGTGG + Intronic
901034895 1:6330603-6330625 GAGCTCCTCCAGGATGTGGGAGG + Intronic
901036124 1:6337255-6337277 CAGCTCACCCAGAAGGTGCTGGG - Intronic
901221680 1:7587039-7587061 CAGCTCCCCCAGAAGGGGAGGGG + Intronic
901638189 1:10680041-10680063 CAGCTCCTGCAGAAAGGCTGGGG + Intronic
902086899 1:13869640-13869662 CAGCTCTTCCAGGAGGTGGGAGG - Intergenic
902740453 1:18434263-18434285 CAACTCCTCAAGCAGGTGGGTGG - Intergenic
902864780 1:19270740-19270762 CAGCTGCACCAGGAGGTGAGGGG - Intergenic
902866999 1:19286177-19286199 CAGCTGCACCAGGAGGTGAGGGG - Exonic
903292947 1:22326196-22326218 CAGCCCCTCCAGCTGGAGTGTGG + Intergenic
903332189 1:22601850-22601872 CAGCTCCTCCAGCACCTGAGAGG - Exonic
903441970 1:23394931-23394953 GAGCTCCTCCAGAGGGTGGAGGG - Intronic
904675939 1:32199350-32199372 CAGATCCTCTGGAGGGTGTGGGG + Intergenic
904954398 1:34270984-34271006 CAGGTCCTCCTCAAGGAGTGTGG + Intergenic
906318895 1:44804765-44804787 CAGCACCTCATGAAGGTGTGAGG + Exonic
906321552 1:44820488-44820510 CATCTCCTCCAGGAGGGGTGGGG - Intronic
907211205 1:52824262-52824284 CAGCTACTCCAGAGGCTGAGGGG - Exonic
908439662 1:64141303-64141325 CAGCTTCTGCAGAAGGTGAACGG + Intronic
909629376 1:77755582-77755604 CAGCTACTCCAGAGGCTGAGTGG + Intronic
910610241 1:89133713-89133735 CAGCTCCTGGGGAAGGGGTGAGG + Intronic
911325239 1:96463504-96463526 CAGTTCCTCAGGAAGGAGTGTGG - Intergenic
911506651 1:98761393-98761415 CAGCTTGCCCAGAAGATGTGGGG - Intergenic
912504603 1:110147749-110147771 GAGGTTCTCAAGAAGGTGTGGGG + Intergenic
912659165 1:111513271-111513293 CACCTCCTGCACAGGGTGTGAGG + Intronic
913292693 1:117289334-117289356 CAGCTACTCCAGAGGCTGAGGGG - Intergenic
913339869 1:117747733-117747755 CACTTCCTTCAGAGGGTGTGTGG + Intergenic
916211144 1:162360894-162360916 CAGCTCCTCCATCAGAAGTGAGG - Intronic
916263594 1:162868494-162868516 CACTTCCTCCAGAGGGTCTGTGG - Intronic
916858253 1:168774429-168774451 CAGCTCAGCCAGCTGGTGTGAGG + Intergenic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
918077309 1:181180517-181180539 CAGCTGATCCAGATGGTCTGTGG - Intergenic
918790686 1:188823415-188823437 CAGCTACTCCAGAGGCTGAGGGG - Intergenic
919847187 1:201649473-201649495 CAGCTGCTGGGGAAGGTGTGGGG + Intronic
920818111 1:209354538-209354560 CAGCCCCTACAGAAGTAGTGAGG - Intergenic
921634525 1:217476971-217476993 CATCTCCTCCAGAAGATGAAAGG - Intronic
922631842 1:227123184-227123206 CAGCTACTCGAGAAGGGCTGAGG + Intronic
924629629 1:245724423-245724445 ATGCTCCTCTAGAAGGTGTCTGG - Intergenic
924691421 1:246355442-246355464 CAGTTCCTTCAGAGGGTCTGTGG - Intronic
1062884231 10:1004460-1004482 CAGCTCCTCCCCATGGTATGTGG + Intronic
1063812894 10:9734539-9734561 CAGCTACTCGAGAGGCTGTGAGG - Intergenic
1067088534 10:43255120-43255142 CAGCCCCTCCAGCCGGTGTCGGG + Intronic
1067744659 10:48926536-48926558 CAGTTCCTCCAAAAGGTCAGTGG - Intronic
1070333277 10:75432749-75432771 CAGCTCCTACAGATGCAGTGAGG + Intronic
1071295396 10:84215721-84215743 CAGCTCTTCCAGAAAGTATTAGG + Exonic
1071843568 10:89498696-89498718 CACCTCCTTCAGAGGGTCTGTGG - Intronic
1072519969 10:96222691-96222713 TAGCTCCTCCACAGGTTGTGCGG + Intronic
1072976685 10:100065180-100065202 AAGCTCTTCCAGAAGGTATGTGG - Exonic
1074183956 10:111085498-111085520 CAGCACCTTCAGAAGGGGCGAGG + Intergenic
1074184444 10:111088466-111088488 CAGCACCTTCAGAAGGGGCGAGG - Intergenic
1075307126 10:121377975-121377997 CAGCCCCACCAGAAGGGGTTGGG - Intergenic
1075418887 10:122286210-122286232 CAGCTCCCTCAGGGGGTGTGTGG - Exonic
1075594270 10:123716690-123716712 CAGCTCATCCAGGAGGTGCCTGG - Intronic
1075624138 10:123949647-123949669 CAACTCCTACAGAAGGAGTGGGG - Intergenic
1076543105 10:131226924-131226946 CAGCGACTCCAGGAGGTGGGAGG - Intronic
1076705110 10:132297218-132297240 CATGTCCTGCAGAGGGTGTGGGG - Intronic
1077123393 11:921476-921498 AAGCTCCTGCATAAGATGTGTGG - Intergenic
1077404353 11:2376531-2376553 TGGCTCTTCCGGAAGGTGTGGGG - Intronic
1077503408 11:2919393-2919415 GGGCTCCTCCAGATGGTGAGTGG + Exonic
1078363893 11:10691342-10691364 CTGCTCCTCCAGGAGGTGTGGGG + Intronic
1081873471 11:46393493-46393515 CAGCTCTTCCAGAAGCTGGCAGG + Intergenic
1082833993 11:57639034-57639056 CTGCACCTCCAGAAGTTGTAGGG + Intergenic
1083225252 11:61280931-61280953 CACCTCCCCCTGAAGGAGTGAGG + Exonic
1083459153 11:62799414-62799436 GACCTCCCTCAGAAGGTGTGAGG + Intronic
1084190289 11:67495559-67495581 CAGCTCCTCCAGAAAGAGGCTGG + Exonic
1084465381 11:69320269-69320291 CAGGTCTTCCAGCAGGTCTGGGG - Intronic
1087767000 11:102165896-102165918 CTGCTTCTCCAGAAGGTGATGGG + Intronic
1087944502 11:104141814-104141836 TACGCCCTCCAGAAGGTGTGTGG + Intronic
1089099596 11:115951282-115951304 CAACTCCTCCATCAGGTCTGGGG + Intergenic
1090598304 11:128342975-128342997 CATCTCCTCCAGAACATGTGTGG - Intergenic
1090746566 11:129710290-129710312 CAGATCCTCCAGCAGGTGATGGG - Intergenic
1091612775 12:2025274-2025296 CAGCTCTTCCAGATGTTCTGTGG - Intronic
1098852267 12:75611068-75611090 CAGCTCCTTCAAAGGGTCTGTGG - Intergenic
1100827597 12:98489542-98489564 CAGCTACTCCAGAGGCTGAGAGG - Intronic
1101407719 12:104443363-104443385 CCTCTCCTCCAGAGGCTGTGGGG - Intergenic
1101544499 12:105698463-105698485 CAGTTCCTTCAAAAGGTCTGTGG + Intergenic
1101664090 12:106793852-106793874 CAACTCCTGGAGAAGGTGGGTGG + Intronic
1101843686 12:108345232-108345254 CACCTCCTGCACAAGGTATGTGG - Intergenic
1102975863 12:117206948-117206970 CAGCTACTCAGGAAGGTGAGAGG - Intergenic
1103513749 12:121493154-121493176 CAGCTACTCCAGAAGCTGAGGGG - Intronic
1103521844 12:121541282-121541304 CAGCTACTCCAGAAGGAGGGAGG + Intronic
1103764326 12:123270669-123270691 AAACTCCTCCAGAAGTTGTCAGG - Intronic
1104136832 12:125948555-125948577 CAGCTACTCAAGAAGCTGAGGGG - Intergenic
1104864016 12:131942091-131942113 CTGCTCCTGCAGCAGCTGTGTGG - Intronic
1104898703 12:132176446-132176468 CAGCTCCTCCAGGAGGACCGTGG - Intergenic
1105251452 13:18702164-18702186 CAGTTCCTGCAAATGGTGTGGGG + Intergenic
1105579835 13:21684925-21684947 CTGTTCCTCCAGCAGGTGAGGGG + Intronic
1106509785 13:30402884-30402906 CATCCCATCCAGAAGGTGGGTGG + Intergenic
1106578996 13:31001513-31001535 CAGCTCCTTCAGAATGGGAGCGG - Intergenic
1107756135 13:43623609-43623631 CACTTCCTTCAGAGGGTGTGTGG + Intronic
1107988203 13:45794062-45794084 TAGCACCTTCAGAAGCTGTGTGG + Intronic
1108272748 13:48778216-48778238 CAAGTGCTCCAGAATGTGTGAGG + Intergenic
1108478479 13:50843561-50843583 CAGCTGCTGCAGCAGGAGTGGGG - Exonic
1108601220 13:51996847-51996869 CAACTCCTCCAAAATGTGTCTGG + Intronic
1108723194 13:53152784-53152806 CAGCTACTCCAGAAGTTGATGGG - Intergenic
1113644246 13:111981171-111981193 CAGCTCCTCCTGAGGCTGTGGGG + Intergenic
1113778010 13:112959955-112959977 CAGCACCTCCTGCAGGTGTGGGG + Intronic
1114329132 14:21618272-21618294 CACTTCCTCCAAAAGGTCTGTGG + Intergenic
1115699059 14:35931201-35931223 CAGCTACTCCAGAGGCTGAGGGG - Intronic
1117092972 14:52268575-52268597 CAGCTCCTCCAGGGGCTGAGGGG - Exonic
1117139929 14:52778899-52778921 CAGCTACTCCAGAGGCTGAGGGG + Intronic
1118849065 14:69571121-69571143 CAACTGCTGCAGAAGGGGTGGGG + Exonic
1121015945 14:90549223-90549245 CTTCTCCTCCAGAGGGAGTGAGG + Intronic
1121459716 14:94065615-94065637 CAGTTCCTTCAGAGGGTCTGTGG - Intronic
1121613649 14:95298293-95298315 CAGATCTGCCAGAAGGTGAGTGG + Intronic
1121848493 14:97196765-97196787 CAGCTCCTTCAAAGGGTCTGTGG + Intergenic
1121880685 14:97498029-97498051 CAGCTCCTGCAGATGGACTGGGG - Intergenic
1122693624 14:103542694-103542716 CAGCCCCTCCAGAGGGGGAGGGG - Intergenic
1122730490 14:103793434-103793456 CAGCTCCTCCACAAGGTGGCAGG - Intronic
1125729218 15:41883351-41883373 CAGCTCCTCCAGCTGGTGGGAGG + Exonic
1126041821 15:44598766-44598788 CAGCTCCTATTGAAGGTATGTGG + Exonic
1126577384 15:50210359-50210381 CAGCTTCTCCAGTATGTGTTCGG - Intronic
1126585523 15:50282081-50282103 CAGCTACTCAAGAGGCTGTGAGG + Intronic
1128497355 15:68206107-68206129 CAGCTTCTGCGGAAGGGGTGGGG - Intronic
1129631617 15:77266826-77266848 CAGCTCCTTCAAAGGGTCTGTGG - Intronic
1130404605 15:83587044-83587066 CAGCTCCTGCAGAATCTCTGTGG - Exonic
1130780189 15:87028888-87028910 CAGCTCCTCCTGGATCTGTGAGG + Exonic
1131182650 15:90250945-90250967 CAGCTCCTCCAGATGTTGAAGGG - Intronic
1133177423 16:4025715-4025737 CCGCAGCTCCAGAAGGTTTGGGG + Intronic
1135332580 16:21573120-21573142 CAGCTACTCAAGAGGGTGAGTGG + Intergenic
1137751871 16:50868891-50868913 CAGCTACTCAAGAAGCTGAGTGG + Intergenic
1137757239 16:50912400-50912422 CAGCCACCCCAGAAGGTGTTGGG - Intergenic
1137758962 16:50925219-50925241 CAGCTCCTTGAGAAGGTGGTGGG - Intergenic
1140471702 16:75218984-75219006 CCGCTGCCTCAGAAGGTGTGGGG - Exonic
1142515002 17:422132-422154 CAGCTCCTCGACAATGTTTGAGG + Intronic
1143426440 17:6843010-6843032 CAGCACCTCCAGCTGGGGTGAGG + Intergenic
1144563512 17:16341291-16341313 CAGCTACTCCAGAAGCTAAGAGG + Intronic
1146339227 17:32005855-32005877 CAGCTACGCCAGAGGGTGAGGGG - Intergenic
1146717425 17:35098346-35098368 CAGCTCCTCGAGAGGCTGAGTGG - Intronic
1147305537 17:39561671-39561693 CAGCTCCAGCAGGAGGTGGGAGG - Intronic
1147341074 17:39753736-39753758 AAGTTCCTCCAGTAGATGTGTGG - Intergenic
1147543666 17:41381891-41381913 GAGCTCCAGCAGAAGGTGAGGGG - Exonic
1147545346 17:41397184-41397206 GAGCTCCAGCAGAAGGTGAGCGG - Exonic
1147851765 17:43449239-43449261 CACCTCCTCCAGGAGGTGGAGGG - Intergenic
1148262587 17:46196127-46196149 CAGCTACTCCAGAAGCTGAGGGG + Intronic
1148536349 17:48442238-48442260 CAGCTCCTACAGAAACTGTGTGG + Intergenic
1148764658 17:50030196-50030218 CAGCTACTCCAGAGGCTGAGAGG - Intergenic
1150117121 17:62562722-62562744 CAGCTACTTCAGAAGGTTTTTGG + Intronic
1151047113 17:70933591-70933613 CAGCTACTCCAGAAGCTGAGGGG + Intergenic
1151528709 17:74690063-74690085 CAGCTACTCCAGAGGCTGAGGGG - Intronic
1151980035 17:77503214-77503236 CAGCTCCTTCAGAACCTCTGGGG - Intergenic
1152075430 17:78156726-78156748 CAGCTACTCCAGAGGTTGAGGGG - Intronic
1152466042 17:80466662-80466684 CAGCATCACCAGACGGTGTGGGG + Intergenic
1152574460 17:81133992-81134014 CAGCTCCTCCACCAGGAGTCGGG + Intronic
1152754042 17:82079594-82079616 CAGCGCCTCCAGCACCTGTGGGG + Exonic
1153045738 18:854336-854358 CAGCTACTCGAGAAGCTGAGCGG - Intergenic
1153611463 18:6890218-6890240 CAGCCCTTCCAGAAGGTGTAAGG - Intronic
1153869370 18:9303064-9303086 CACTTCCTTCAGAAGGTCTGTGG - Intergenic
1154083701 18:11281602-11281624 CCTCACCTCCAGAAGGTGTAGGG - Intergenic
1154151138 18:11907603-11907625 CTGCTACTCGAGAAGTTGTGGGG - Intronic
1155055278 18:22176949-22176971 CAGGTCCTCCAGCAGGTCTGCGG - Exonic
1155172247 18:23275560-23275582 CAGCTCCTGAAGAGGCTGTGAGG - Intronic
1155621537 18:27785741-27785763 CAGATGTTCCAGAAAGTGTGAGG - Intergenic
1157917490 18:51680417-51680439 CTGTTCCTCCAGAATGTGGGAGG - Intergenic
1158902714 18:61981176-61981198 CAGCTACTCCAGAGGCTGAGCGG - Intergenic
1158941789 18:62411565-62411587 CTGAGCCTCCAGAAGGAGTGTGG - Intergenic
1159786961 18:72726475-72726497 CACTTCCTTCAGAAGGTCTGTGG - Intergenic
1160113421 18:76055299-76055321 CAAGTCCTCCGGAAAGTGTGAGG + Intergenic
1160559584 18:79747684-79747706 CAGCGCCTCCTGCAGGTGTCCGG + Intronic
1161001228 19:1912262-1912284 CACCTCCTTCAGGAGGCGTGAGG - Exonic
1161378142 19:3950529-3950551 CAGCTCCCCCAGAATGTGCAGGG - Intergenic
1161465629 19:4428775-4428797 CAGCTCCTCCAGCAGCAGAGCGG + Exonic
1162538174 19:11276716-11276738 CGCCCCCTCCAGAAGGTGGGGGG - Intergenic
1162621513 19:11847914-11847936 GAGCAGCTCCAGAAGGAGTGTGG + Intergenic
1162625298 19:11880184-11880206 GAGCAGCTCCAGAAGGAGTGCGG + Intronic
1162635446 19:11964193-11964215 GAGCAGCTCCAGAAGGAGTGTGG + Intronic
1163106293 19:15124917-15124939 CAGCTGCTGCACAAGGTGCGGGG - Exonic
1163261609 19:16194005-16194027 CAGCTACTCCAGAGGCTGAGAGG - Intergenic
1163337356 19:16682014-16682036 CATCTCCTCCAGAGGATGGGTGG + Intronic
1163489396 19:17607993-17608015 CAGCTACTCCAGAGGGTGAGGGG - Intronic
1164063224 19:21693184-21693206 GAGCTTCTCCAAAAAGTGTGGGG + Intergenic
1164818861 19:31228410-31228432 CAGCTACTCCAGAGGCTGAGGGG + Intergenic
1165088057 19:33364952-33364974 GAGCTCCTCCAGGAGGAGAGAGG - Intergenic
1165103323 19:33453198-33453220 CAGCTACTCCAGAGGCTGAGGGG + Intronic
1165732564 19:38155705-38155727 CAGCTCCCCCAGATGCTGTGGGG + Intronic
1166338684 19:42123952-42123974 CAGCTCCTTTAGTAGGAGTGGGG - Intronic
1167916733 19:52745929-52745951 CAGCTGCTCCTGCAGGCGTGGGG + Intergenic
1167980274 19:53269977-53269999 CACCCCGTCCAGAAGGTGAGGGG - Intergenic
924962545 2:46799-46821 CAGCGCCGCCGGAAGGTGAGGGG - Intronic
925415868 2:3669787-3669809 CTGCTCCTCCCGGAGGTGGGAGG + Intronic
926207068 2:10841352-10841374 CATCCCCTCCTGAAGGTCTGGGG - Intergenic
926241769 2:11094226-11094248 AGGCTCCTCCAGAGGGTCTGTGG + Intergenic
926777797 2:16439368-16439390 CAGCTCCTCCAGGTCGTATGTGG - Intergenic
929600557 2:43201742-43201764 AGGCTCCTCCAGGAAGTGTGAGG + Intergenic
930719787 2:54627952-54627974 CATCTTCCCCTGAAGGTGTGGGG + Intronic
930722635 2:54652657-54652679 CAGCTCCTACAGAAGGTAAATGG - Intronic
931071656 2:58658383-58658405 ATGCTCCCCCAGAAGCTGTGGGG - Intergenic
931670808 2:64645061-64645083 AAGCTCATCCAGAATGTCTGAGG + Intronic
932264212 2:70353080-70353102 CAGCTGCTCCTGAAAGTGGGAGG + Intergenic
936166343 2:110122993-110123015 TATCTCCTACAGTAGGTGTGAGG + Exonic
936773236 2:115940254-115940276 CAGCTCCTTGAAAAGATGTGAGG - Intergenic
936995538 2:118410029-118410051 CAGCTACTCCAGAGGCTGAGAGG + Intergenic
938120264 2:128628220-128628242 AAGCTCCTCCACAGGCTGTGAGG + Intergenic
938745382 2:134273115-134273137 CATTTCCCCCAGAAGGTGGGGGG + Intronic
940419248 2:153459366-153459388 CAGCTACTCAAGAAGTTGAGAGG + Intergenic
940649492 2:156427184-156427206 CAGCTCCTTCAGAATTTGTCTGG - Intergenic
942431955 2:175921269-175921291 CAGCTACTCCAGAGGCTGAGAGG - Intergenic
943364828 2:186958905-186958927 CAGCTACTCCAGAAGATGATGGG + Intergenic
943621284 2:190150587-190150609 CACTTCCTTCAGAGGGTGTGTGG + Intronic
943949913 2:194120394-194120416 CAGCTCATGCTGAAGATGTGAGG - Intergenic
944736958 2:202575755-202575777 CAGCTCTTACAGATGGTGTCCGG - Intergenic
945265671 2:207889153-207889175 AAGCTCCTCCTGAATGTATGGGG - Intronic
945549681 2:211205347-211205369 GAGTTCCTTCTGAAGGTGTGAGG + Intergenic
945604471 2:211911377-211911399 CAGCTACTCTAGAAGATGAGTGG - Intronic
946661669 2:222007489-222007511 CAGCTCCTCAGGAGGCTGTGAGG + Intergenic
947889414 2:233603787-233603809 CAGATCCTCCAGAATGTATGAGG - Intergenic
947890846 2:233617943-233617965 CAGATCCTCCAGAGTGTATGAGG - Exonic
948187469 2:236032781-236032803 CAGGTCCGCAAGAAGGTATGAGG + Intronic
948653098 2:239461296-239461318 CAGCTCCTCCCCAAGCTTTGGGG - Intergenic
948657252 2:239484268-239484290 CAGCTCCTGCAGAAGAAGCGAGG + Intergenic
1169778929 20:9288004-9288026 CAGCTCCACCAGCAGGATTGTGG + Intronic
1170572300 20:17639242-17639264 CAACTCCTGCAGACAGTGTGTGG + Intronic
1172766992 20:37356247-37356269 CAGCTCCTCTTGGAGGTCTGAGG + Intronic
1173940359 20:46905683-46905705 CAGCTCCTGGAGAGGGTATGGGG + Intronic
1174294804 20:49538139-49538161 CAGCTACTCAAGAAGCTGAGGGG + Intronic
1174368928 20:50073306-50073328 CAGCTTCTGAAGAAGGTGGGTGG + Intergenic
1174570086 20:51495196-51495218 CAGCTACTCCAGAGGCTGAGGGG - Intronic
1176082130 20:63278832-63278854 CTGCTCCTCCCGAGGGCGTGGGG - Intronic
1176836979 21:13802050-13802072 CAGTTCCTGCAAATGGTGTGGGG + Intergenic
1178320391 21:31600727-31600749 TGGCTCCTCCAGAGGCTGTGAGG - Intergenic
1178428106 21:32495272-32495294 CTGCTCCTCCTGAAGCTGTTTGG + Intronic
1179148944 21:38794093-38794115 CAGATGCTCCAGCAGGAGTGAGG + Intergenic
1179873756 21:44257039-44257061 AAGCTCCTACAGAAGGGGTGTGG - Intronic
1180746268 22:18091114-18091136 CAGCTACTCCAGAGGCTGAGGGG - Exonic
1181179369 22:21056016-21056038 GAGCCCCTGCAGAAGGTGGGAGG - Intronic
1181760039 22:25052011-25052033 CAGCTCCCCCAGCAGCTGTGTGG - Intronic
1182427281 22:30281205-30281227 CAGCTACTCAAGAGGCTGTGAGG - Intergenic
1183514925 22:38259629-38259651 CAGAGCCTCCAGAAGGAGTATGG + Intronic
1183601924 22:38844665-38844687 CTGCTCCTTCAGAAGGTTGGAGG - Intergenic
1185188704 22:49418925-49418947 TAGAGCCTCCAGAAGGAGTGTGG - Intronic
1185285496 22:49998017-49998039 CAGCTCTGCCTGAAGGTGAGGGG - Exonic
1185371224 22:50461788-50461810 CCGCCCATCCAGAAGGTTTGCGG - Exonic
950580569 3:13859267-13859289 AACCTCCTCCAAAATGTGTGAGG + Intronic
950603683 3:14058504-14058526 CACTTCCTCCAGAGGGTCTGTGG + Intronic
950653470 3:14422304-14422326 CAGCTCTGCCAGCAAGTGTGTGG - Intronic
951289063 3:20853767-20853789 CATCTCCTCAAGAAAGTCTGAGG - Intergenic
951748965 3:26012618-26012640 CAGATCAGCCAGAAGGTGTGCGG - Intergenic
951818050 3:26777397-26777419 CAGATACTTCAGAAGGTGGGAGG + Intergenic
952736057 3:36692592-36692614 CAGCTACTCCAGAGGCTGAGTGG + Intergenic
952772827 3:37017853-37017875 CAGCACCTCCTGATGGGGTGAGG - Intronic
954110897 3:48432378-48432400 CCCCTCCTCCAGAGGGTCTGAGG - Exonic
954803192 3:53199289-53199311 CATGTCCTCCAGCAGGTGGGTGG + Intergenic
955212385 3:56954316-56954338 CAGCTCCTCCTGTTGGGGTGGGG - Intronic
955338132 3:58103953-58103975 CAGCTCCTCCAGACCCTCTGTGG - Exonic
955936391 3:64106876-64106898 CAGATCCTCCAGAGGATGTAGGG - Intronic
959121297 3:102235793-102235815 GAGATCATCCAAAAGGTGTGTGG + Intronic
959656491 3:108811292-108811314 CAGCTACTCCAGAGGCTGAGCGG - Intergenic
960285152 3:115819868-115819890 CTGCTCCTACAGAAGGTGATGGG - Intronic
960516418 3:118607595-118607617 CACTTCCTTCAGAGGGTGTGTGG - Intergenic
960555937 3:119030727-119030749 CAGATCCTCCAGATGGTGTGGGG + Intronic
961048633 3:123727277-123727299 CAGACCACCCAGAAGGTGTGGGG + Intronic
961172558 3:124808352-124808374 CAGGACCTCCAGAAGATGTGTGG + Intronic
961674664 3:128557219-128557241 CAGCTTCCCCAGCCGGTGTGAGG + Intergenic
961765282 3:129205675-129205697 CATCTCCTCCTGAGGGTGTGTGG - Intergenic
963238158 3:142975498-142975520 CAGCTCCACCTGAAGGTGCTGGG + Intronic
963373933 3:144438398-144438420 CAGTTCCTTCAGAGGGTCTGTGG + Intergenic
963733881 3:148997544-148997566 CAACTTCTCCAAAAGATGTGAGG - Intronic
964160506 3:153640351-153640373 CACATCCTTCAGAAGGTCTGTGG - Intergenic
966229974 3:177641070-177641092 CAGTTCCTTCAGAGGGTCTGTGG + Intergenic
966998558 3:185309394-185309416 CAGCTACTCCAGAGGCTGGGAGG + Intronic
968447715 4:660691-660713 CAGGTGCCCCAGAAGGTGAGGGG + Intronic
968472287 4:787663-787685 CAGAGCCTCCAGAGGGAGTGTGG + Intronic
968478010 4:821424-821446 CAGGTCCTCGGGAATGTGTGGGG - Intronic
968690020 4:1985540-1985562 CAGCCCCTCCAGCAAGCGTGGGG + Intronic
968864490 4:3199108-3199130 CAGCTCCTGGAGAAGGAGTCAGG - Intronic
970050223 4:11905861-11905883 CAGCTCCTCCATCATCTGTGCGG - Intergenic
970859393 4:20684257-20684279 CTGCTCCTGCAGAAGGTGAAGGG + Intergenic
971388640 4:26164832-26164854 CAGCAATTCCAGAAGGTGTGGGG + Intronic
972425844 4:38931955-38931977 CAGGTGCTAAAGAAGGTGTGTGG - Intronic
973267784 4:48228745-48228767 CATCTGCTCCAGCAGGGGTGAGG - Intronic
975008616 4:69321653-69321675 GAGCTCCTCCAGAATCTGTGAGG + Intronic
975163936 4:71155574-71155596 CAGCTACTCAGGAAGCTGTGGGG - Intergenic
977777475 4:100938620-100938642 CAGCTCCTTCAAAGGGTCTGTGG - Intergenic
979030224 4:115633791-115633813 CAGTTCCTTCAAAAGGTCTGTGG + Intergenic
979519197 4:121646636-121646658 CTGCTACTCAAGCAGGTGTGGGG - Intergenic
979939232 4:126738971-126738993 AAGCTCCTCCAGAAAATATGAGG + Intergenic
981279827 4:142945309-142945331 CAGATCCTACGGAAGGAGTGAGG + Intergenic
982994454 4:162323379-162323401 CAGCTCCTTCATAGGGTATGTGG + Intergenic
985018828 4:185665844-185665866 CAGCTCCTCCAGCATGGCTGTGG + Intronic
985753093 5:1694068-1694090 CAGATCCTCCAGAAGGTCTGAGG - Intergenic
985947191 5:3194977-3194999 CAGCCCCTGCAGAAGGTGCCTGG + Intergenic
986238746 5:5937811-5937833 CAGAACCCCCAGAAGGTGTCGGG - Intergenic
986745003 5:10736160-10736182 CAGCGCCTGCAGAGGGAGTGTGG + Intronic
986753346 5:10810794-10810816 CCTCTCTTTCAGAAGGTGTGGGG + Intergenic
988930398 5:36031116-36031138 AAGATACTCCAGAAGGTGTGGGG + Intergenic
989999361 5:50875160-50875182 CACCTCCTCCATCAGATGTGTGG + Intergenic
991528949 5:67594401-67594423 CATCCCCTCCAGTAGGTGGGAGG - Intergenic
993920566 5:93795447-93795469 CAGTTCCTTCAGAGGGTCTGTGG + Intronic
994840916 5:104923979-104924001 CTGCCACTCCAGAAGGTGCGAGG + Intergenic
996547795 5:124698868-124698890 CAGCTGTTCCAGAAAGTTTGTGG + Intronic
997870498 5:137501426-137501448 CAGCCCGTCCAGAAGGTCAGAGG - Intronic
1001970848 5:175953880-175953902 CAGCTCTTGGAGAAGGTTTGAGG - Intronic
1002069392 5:176670344-176670366 GAGCTCCTCCAGAGAGTGTAAGG - Intergenic
1002246590 5:177889884-177889906 CAGCTCTTGGAGAAGGTTTGAGG + Intergenic
1003592835 6:7450017-7450039 CAGCTCCTCCAGAATTTATCTGG + Intergenic
1006976276 6:38105291-38105313 CAGCTACTCCAGAAGCTGAGGGG + Intronic
1011333372 6:86234424-86234446 CTGCTCCACCAGGAAGTGTGGGG + Intergenic
1011471268 6:87710159-87710181 CAGCTGCAGTAGAAGGTGTGAGG - Intergenic
1012515326 6:100052934-100052956 CACTTCCTCTAGAAAGTGTGTGG - Intergenic
1014534923 6:122603592-122603614 CAGCTACTCCAGAGAGTCTGAGG - Intronic
1017823965 6:158068287-158068309 CAGCTGCTGCAGAAAGTGAGAGG - Intronic
1019158952 6:170056947-170056969 CAGCTCACCCAGCATGTGTGAGG + Intergenic
1020210951 7:6157944-6157966 CAGCTCCTCTCGAGGGTGAGCGG - Intronic
1022034625 7:26521852-26521874 CAGCTCCTCCAGGAGTCATGTGG - Intergenic
1022312379 7:29209169-29209191 CAGCCTCTCCTGAAGGGGTGAGG + Intronic
1022649218 7:32259476-32259498 CAGCTCCCCCAGCTGGTGGGAGG - Intronic
1023776286 7:43610551-43610573 CAGCTACTCCAGAGGCTGAGGGG + Intronic
1023882039 7:44326115-44326137 CATCTCTTCCTGAGGGTGTGAGG - Intronic
1026216401 7:68353278-68353300 AGGCTCCTCCTGAGGGTGTGGGG - Intergenic
1026261146 7:68756541-68756563 CAGCTACTCCAGAGGCTGAGTGG - Intergenic
1026470791 7:70693248-70693270 CAGTGCCCCCAGAGGGTGTGGGG - Intronic
1026769834 7:73188698-73188720 TAGCTTCTGCAGGAGGTGTGGGG - Intergenic
1027010702 7:74742080-74742102 TAGCTTCTGCAGGAGGTGTGGGG - Intronic
1027077340 7:75203960-75203982 TAGCTTCTGCAGGAGGTGTGGGG + Intergenic
1028086386 7:86642754-86642776 CAGATCCTCATGAAGCTGTGTGG - Intergenic
1028197692 7:87926563-87926585 CAGTTCCTTCAAAAGGTCTGTGG - Intergenic
1028822514 7:95229262-95229284 CAGTTCCTTCAAAAGGTCTGTGG - Intronic
1029459047 7:100685041-100685063 AAGCACCTGCAGCAGGTGTGGGG - Exonic
1029848777 7:103441508-103441530 CAACTACTTGAGAAGGTGTGAGG + Intronic
1033642943 7:143279816-143279838 CAGCTTCTCCAAAATGTGTAAGG - Intergenic
1034104844 7:148481610-148481632 CAGCCCATCCAGAAGTTGTGGGG - Intergenic
1034773144 7:153799049-153799071 CACCTCCTCTAGGAGGTGTGCGG + Intergenic
1035652817 8:1281685-1281707 CAGCTCCTCCTTAGGGAGTGTGG - Intergenic
1035710439 8:1709610-1709632 CAGCTCCCCCAGAATGAGAGAGG + Intergenic
1035734851 8:1880851-1880873 CGGCTGCTCCAGAAGCTGTGTGG - Intronic
1036601784 8:10267682-10267704 CTGATCCCCCAGCAGGTGTGGGG - Intronic
1036629059 8:10497519-10497541 CACCTCCTCAAAAAGGTATGGGG - Intergenic
1037949046 8:23007012-23007034 CGGGTCCTCCAGGAGGTGGGCGG - Exonic
1040276454 8:46016441-46016463 CAGCTCCTGCACAGGGTCTGTGG - Intergenic
1040393766 8:46975262-46975284 CAACTCCTCAAGAGAGTGTGGGG + Intergenic
1040656678 8:49518694-49518716 CTGCTCCTCCAAATGGTGGGAGG + Intergenic
1041227630 8:55716484-55716506 CGCCTCCTTCAGAGGGTGTGTGG - Intronic
1041377735 8:57219821-57219843 CAGCTCCCCAAGAAGGTATCAGG - Intergenic
1043876489 8:85492000-85492022 CAGTTCCTTCAGAGGGTCTGTGG + Intergenic
1043968334 8:86504253-86504275 TAGATCCTCCAGCAGTTGTGGGG + Intronic
1045183261 8:99809792-99809814 CACCTCCACCAGAAGGTAGGTGG - Intronic
1045782724 8:105886671-105886693 CAGCTGCTCCAGACGGGCTGCGG - Intergenic
1046380216 8:113439761-113439783 TAGTTTCTCCAGAAGGGGTGGGG + Intergenic
1047624774 8:126645448-126645470 CAGTTTCTCCAGCAGGAGTGTGG + Intergenic
1048233027 8:132662484-132662506 CACATCCTACAGAAGATGTGAGG - Intronic
1049245229 8:141558874-141558896 CAGCACCGCGAGAAGGTGAGAGG - Intergenic
1049788648 8:144463004-144463026 CCGCCCCTGCAGAAGGTGGGCGG + Intronic
1050513481 9:6418108-6418130 CAGCTCCTCCAGAATTAGTAAGG + Intronic
1053134797 9:35643862-35643884 CAGCTACTCCAGAGGTTGGGAGG + Intronic
1054930558 9:70630544-70630566 AGTCTCCTCCAGAAGGTGTTTGG - Intronic
1055156272 9:73066702-73066724 CAGTTCCTTCAGAAGGTCTGTGG - Intronic
1056115669 9:83438977-83438999 CAGCTCCTGCAAAAGAGGTGAGG - Intronic
1056495169 9:87148773-87148795 CATCTCCTCCTGGGGGTGTGGGG + Exonic
1057227007 9:93297773-93297795 CAGCTCCTCCAGGAGGGAGGTGG - Intronic
1057298352 9:93862157-93862179 CAGCTCCTCCTGGAGGTAGGAGG + Intergenic
1057303430 9:93899434-93899456 CAGCTCCTCCTGAAGGGAAGAGG + Intergenic
1057540203 9:95960630-95960652 TAGAGCCTCCAGAAGGAGTGTGG + Intronic
1058691929 9:107527401-107527423 CAGCATCTCAAGAAGGTCTGGGG + Intergenic
1058874277 9:109229603-109229625 CAGCTCCTCCAGAAGGTGTGTGG - Intronic
1059830195 9:118086615-118086637 CAGCTCCACCAAGGGGTGTGGGG + Intergenic
1060536053 9:124389045-124389067 AAGCTGCCCCTGAAGGTGTGAGG + Intronic
1062214946 9:135384135-135384157 CAGCTCCTCCAGAGGGGGGCTGG + Intergenic
1062699424 9:137891265-137891287 CAGCTGCTCCAGAGAGAGTGGGG - Intronic
1186308342 X:8289725-8289747 CAGTTCCTTCAGAGGGTCTGTGG - Intergenic
1187738693 X:22331195-22331217 CAGGTCCTTGAGAAGGTGAGAGG + Intergenic
1189567136 X:42254749-42254771 CAGTTCCTTCAGAGGGTCTGTGG - Intergenic
1190333380 X:49248991-49249013 CAGCTCTGCCTGAGGGTGTGAGG - Intronic
1190554300 X:51618258-51618280 CAGCTTCTGCAGCAGGTGCGGGG - Intergenic
1190560595 X:51682216-51682238 CAGCTTCTGCAGCAGGTGCGGGG - Intergenic
1190563696 X:51711105-51711127 CAGCTTCTGCAGCAGGTGCGGGG + Intergenic
1193057553 X:77169241-77169263 CAGCTCCTTCAAAAGGTCTGTGG + Intergenic
1194405771 X:93494180-93494202 ACGCTCCTCCACAAGGTGTCTGG - Intergenic
1195262157 X:103143251-103143273 CAGCTACTCCAGAGGCTGAGTGG - Intergenic
1196685862 X:118509798-118509820 CACTTCCTCCAGAAGCTGTAGGG + Intronic
1199039263 X:143091796-143091818 CAGCACCTCCACAGGGTGTCAGG + Intergenic
1199121537 X:144060621-144060643 CAGTTCCTTCAAAAGGTCTGTGG - Intergenic
1200123519 X:153802489-153802511 CCCCTGCTCCAGATGGTGTGGGG + Exonic
1200138165 X:153884979-153885001 CCCCTTCTCCAGAAGGAGTGGGG - Intronic
1200696809 Y:6368248-6368270 CAGCTGCTCCTGAGGCTGTGTGG + Intergenic
1200888547 Y:8297607-8297629 CAGCTCCTAAAGAAGGTTAGCGG - Intergenic
1200983766 Y:9285667-9285689 CAGCACCTCCAGAAGGTGGTGGG + Intergenic
1201037304 Y:9796451-9796473 CAGCTGCTCCTGAGGCTGTGTGG - Intergenic
1201669199 Y:16497594-16497616 CAGTACCTCCAGCAGGCGTGGGG + Intergenic