ID: 1058876694

View in Genome Browser
Species Human (GRCh38)
Location 9:109250734-109250756
Sequence ACCAGATCATTCTACTATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058876693_1058876694 19 Left 1058876693 9:109250692-109250714 CCTGGGGTGTGGCTGCGGAGGAT No data
Right 1058876694 9:109250734-109250756 ACCAGATCATTCTACTATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058876694 Original CRISPR ACCAGATCATTCTACTATAC AGG Intronic