ID: 1058877299

View in Genome Browser
Species Human (GRCh38)
Location 9:109255615-109255637
Sequence CCAAAGGTGTTTGCAGGTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058877295_1058877299 16 Left 1058877295 9:109255576-109255598 CCGCAGTCGGAAGAATGCGTGGT 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1058877299 9:109255615-109255637 CCAAAGGTGTTTGCAGGTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 165
1058877293_1058877299 24 Left 1058877293 9:109255568-109255590 CCTGGCGTCCGCAGTCGGAAGAA 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1058877299 9:109255615-109255637 CCAAAGGTGTTTGCAGGTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058877299 Original CRISPR CCAAAGGTGTTTGCAGGTCC TGG Exonic
901160859 1:7175803-7175825 CCCCAGGTATTTGCAGGTCCTGG + Intronic
901261759 1:7876352-7876374 CAAAAGGTGTGTGCAAGTGCTGG - Intergenic
901825447 1:11858362-11858384 CCACAGGTGTCTGGAAGTCCCGG - Exonic
902809312 1:18879355-18879377 CCACAGGTGTTTGAAGGTGCTGG + Exonic
903367807 1:22815755-22815777 CCAGAGTGGTTTGCAGGCCCTGG + Intronic
904280590 1:29415596-29415618 TAGAAGGTGTTTGCAGCTCCAGG - Intergenic
904585921 1:31580558-31580580 CCAGAGGAGTCTGCAGGGCCGGG - Intronic
906630296 1:47361683-47361705 CAAAAGTTGCTTACAGGTCCGGG - Intronic
907430442 1:54408091-54408113 CCAGAGGTGTCCGCAGGGCCTGG - Intronic
909831589 1:80198196-80198218 ATAAAGGTGTTGGCAGGGCCAGG + Intergenic
911251501 1:95581646-95581668 CCAAAGATCTTTGAAAGTCCTGG - Intergenic
913225002 1:116691338-116691360 CCGAGGGTGTCTGCAGGACCTGG + Intergenic
917001558 1:170367072-170367094 CCACTGGTATTAGCAGGTCCAGG + Intergenic
919459866 1:197863817-197863839 CCAAAGATCTGTCCAGGTCCAGG + Intergenic
919478404 1:198056447-198056469 CCAGTGGTGTGTGCAGGTACTGG + Intergenic
922554209 1:226520700-226520722 CCACAGGAGGTTGCAGGTGCTGG - Intergenic
924658887 1:245998069-245998091 TCACAGGTGTTGGCAGGCCCTGG - Intronic
924819417 1:247474259-247474281 CCACAGTAGTTTTCAGGTCCAGG - Intergenic
1063880651 10:10528332-10528354 GCCAAGGTGTCTGCAGCTCCAGG - Intergenic
1066604114 10:37142530-37142552 CCAAAGTTGTTTGGTGGTACAGG + Intronic
1067215593 10:44300119-44300141 CTAAGGGTGTTAGCAAGTCCTGG - Intergenic
1067377885 10:45744483-45744505 CCAAATGTGGTGGCTGGTCCTGG - Intronic
1067885585 10:50085160-50085182 CCAAATGTGGTGGCTGGTCCTGG - Intronic
1068657711 10:59591899-59591921 GCACAGGTGTTAGCGGGTCCAGG - Intergenic
1070639270 10:78154856-78154878 CCATAGATGTCTGCAGGTCAGGG + Intergenic
1071472560 10:85994092-85994114 TCAAAGCCGTTTGCAGCTCCTGG - Intronic
1071499760 10:86194959-86194981 CCAAAGGCCTTTGCAGTCCCAGG - Intronic
1074378400 10:112957910-112957932 TCAAAGGTGTTTGCCAGGCCAGG + Intronic
1075821723 10:125319058-125319080 CCAAAGTTGTTTTCAGGTTTTGG + Intergenic
1077166879 11:1146213-1146235 CAAACCGTGTTTGCAGATCCAGG + Intergenic
1077434633 11:2532905-2532927 GCAAAGGTGTTTGCAGCCCTTGG + Intronic
1080047215 11:27821537-27821559 CCAGAGCTGTTGGCAGGGCCAGG - Intergenic
1082741524 11:56916768-56916790 CCACAGCTGTATGCAGGTCATGG - Intergenic
1083672347 11:64306280-64306302 CCAAAGGTGTGCGCAGGTTGGGG + Exonic
1089807265 11:121102297-121102319 CTAAAGATGCATGCAGGTCCCGG - Intronic
1089899668 11:121967418-121967440 CAAAAGGAGTTGGCAGGTCACGG + Intergenic
1093119136 12:15246447-15246469 CCAAATGTGTTGGCAGGAACAGG - Intronic
1096542343 12:52314802-52314824 CCACAGGTGTCAGCAGCTCCCGG - Exonic
1096864051 12:54550727-54550749 CCAAATGTGCTTGGAGATCCTGG - Intronic
1100776507 12:97980025-97980047 GCACTGGTGTTGGCAGGTCCAGG - Intergenic
1101016372 12:100505025-100505047 GCAAAGTTGTTTGCTGTTCCTGG - Intronic
1102443901 12:112986655-112986677 CTAATGGTGTGTGCAGGTGCTGG + Intronic
1103419310 12:120767447-120767469 CCGGAGATGTTGGCAGGTCCAGG + Exonic
1105535372 13:21260150-21260172 CCAAAGGTGTGCGCAGGTTGGGG + Intergenic
1111261546 13:85746801-85746823 ACAAAGTTTTTTACAGGTCCAGG - Intergenic
1112727408 13:102320378-102320400 CCAGAAGTGTTTGCAGGGTCAGG - Intronic
1114156951 14:20115219-20115241 GCACAAGTGTTTTCAGGTCCTGG + Intergenic
1116118830 14:40694891-40694913 CCAAAGGGGGTTGCAGTTGCCGG + Intergenic
1117817106 14:59609664-59609686 CTAAAGGTCTTTGACGGTCCGGG + Intronic
1118337416 14:64865838-64865860 ATGAAGGTGTTTGCAGGTACGGG - Intronic
1122467904 14:101946925-101946947 CAAAAGCTGTGTGCAGGGCCAGG + Intergenic
1122894408 14:104749178-104749200 CCAAATCTGTATTCAGGTCCAGG - Intergenic
1124336127 15:28858436-28858458 ACAACGGTGTTGGCTGGTCCTGG + Intergenic
1124412883 15:29451359-29451381 CCACAGGAGTCTGCAGGACCAGG + Intronic
1124566949 15:30824749-30824771 GCAAAGATGCTTGCAGCTCCCGG - Intergenic
1124884585 15:33673083-33673105 CCAAATGTGTTTGTAGCTCATGG - Intronic
1125411751 15:39413390-39413412 CTAAAGATGTTTCCAGTTCCAGG - Intergenic
1126929074 15:53626588-53626610 CCAAAGGGGGTTGCAGTTGCTGG + Intronic
1127392931 15:58521532-58521554 CCATAGCTGCTCGCAGGTCCCGG - Intronic
1127410216 15:58697766-58697788 GCACTGGTGTTAGCAGGTCCAGG - Intronic
1129070593 15:72946878-72946900 GCATTGGTGTTAGCAGGTCCAGG - Intergenic
1131927420 15:97401113-97401135 CCAAAGGTCTTTGCAGGCTGTGG - Intergenic
1137527790 16:49251341-49251363 ACCAAGGTGTTGGCAGGGCCAGG + Intergenic
1140357563 16:74319347-74319369 CCATAGGTTGGTGCAGGTCCAGG - Intergenic
1141032409 16:80601387-80601409 CCAAAGGTAATTGCAGGACGGGG + Exonic
1141208753 16:81956891-81956913 CCAAAAGTTTTTGCAGGTGGAGG - Intronic
1141431319 16:83971676-83971698 ACAGAGGTGTTTGCAAGGCCTGG - Intronic
1145904077 17:28506887-28506909 CCAAGGGTGTGTGCAGATCAAGG + Intronic
1147568522 17:41552486-41552508 CAAAAGCTGTTGGCAGTTCCTGG + Intergenic
1148354496 17:46966640-46966662 CAAAAGGTATTTGGAGGTCAGGG - Intronic
1149065848 17:52478419-52478441 CCAAAGGTCTTTTCAGGACAAGG - Intergenic
1150134436 17:62688282-62688304 CCCACAGTGTTTTCAGGTCCAGG + Exonic
1150291839 17:63986948-63986970 CCATAGGTGCTTGAAGGTCATGG - Intergenic
1157305259 18:46512287-46512309 CAAGAGCTGTTGGCAGGTCCAGG - Intronic
1157820918 18:50767720-50767742 ACATTGGTGTTAGCAGGTCCAGG - Intergenic
1158104657 18:53871901-53871923 ACAAAGGCGTTTGCTGATCCAGG - Intergenic
1158242879 18:55397272-55397294 CTAAAGGTTTATGCAGGTTCAGG - Intronic
1158553048 18:58453274-58453296 CCAAAGGAGGCTGCAGGTACAGG - Intergenic
1159574133 18:70155583-70155605 TCAAAGGTCTGTGCAGGTCATGG - Intronic
1159671487 18:71226464-71226486 CCAGAGATGTTGGCAGGTCCAGG - Intergenic
1159988696 18:74876701-74876723 CCAAAGGTGTTTCCTGAACCAGG - Intronic
1161506793 19:4648490-4648512 CCCCAGGTGTCAGCAGGTCCCGG + Intronic
1163014240 19:14444141-14444163 GCAAATGTGTATGCAGGTGCAGG - Intronic
1163427568 19:17247519-17247541 CCAAAGATCCTAGCAGGTCCAGG - Intronic
1163818484 19:19482548-19482570 CCCAGGTTGTCTGCAGGTCCTGG + Intronic
925286245 2:2717368-2717390 CCAAAGGTCGCTGCAGCTCCTGG - Intergenic
926724500 2:15986847-15986869 CCAAATGCCTGTGCAGGTCCTGG - Intergenic
927080567 2:19625932-19625954 CCAATGGTGTATGCAGGTGCTGG - Intergenic
927288995 2:21386445-21386467 CCAAATGTGATTGCAGTTTCAGG + Intergenic
931110960 2:59111128-59111150 CCAAAGGTTTATGCAGATGCTGG - Intergenic
936785849 2:116094001-116094023 GCACTGGTGTTAGCAGGTCCAGG + Intergenic
937256403 2:120559068-120559090 CCCAGGGGGGTTGCAGGTCCTGG + Intergenic
937845472 2:126574295-126574317 CCAAAGGAGGATGCAGGTCCAGG - Intergenic
941450588 2:165655658-165655680 ACCAAGGTGTTGGCAGGGCCCGG + Intronic
941934861 2:170974409-170974431 CCAGAGCTGTTTGTAGTTCCGGG - Intergenic
942947460 2:181685190-181685212 CCAAAGGGGATCGCAGGGCCAGG + Intergenic
943575344 2:189625349-189625371 CCAAATGTGTATGCAGCTCTGGG - Intergenic
944048656 2:195440875-195440897 GCACTGGTGTTAGCAGGTCCAGG - Intergenic
944129031 2:196326111-196326133 TCAAAGGTCTTTGGAGGTTCAGG - Intronic
944260114 2:197667875-197667897 GCACTGGTGTTAGCAGGTCCAGG + Intronic
948187175 2:236030553-236030575 CCAAAGGTGTTTGCCCCTCAGGG + Intronic
1169338611 20:4778607-4778629 CCAAAGGTGCTGGCAGTTCTTGG - Intergenic
1171479336 20:25441126-25441148 ACAAAGGTGTTCCCAGGTACAGG - Intronic
1175637655 20:60599099-60599121 CCAGAGGTGTTTGTGGGTCAGGG - Intergenic
1178068290 21:28932086-28932108 TCAAAGGTCTTTGAGGGTCCTGG + Intronic
1178995956 21:37400043-37400065 ACCAAGGTGTTGGCAGGGCCAGG + Intronic
1183078850 22:35443581-35443603 CCAAGGGTGTGAGCAGGTTCAGG - Intergenic
1183667742 22:39255073-39255095 CCAAGGGGGTTTCCAGGCCCAGG + Intergenic
1184727436 22:46355119-46355141 CCACAGGTGGTTGCAGGTAGAGG + Intronic
949709715 3:6860521-6860543 CCAAAGGGGTTTCCAGGGCCAGG - Intronic
950426133 3:12925696-12925718 CCCAAGGTGTGTGCAGAACCAGG + Intronic
950501445 3:13366425-13366447 CCAAAGGTGATTTCAGGGCTGGG - Intronic
950892738 3:16419141-16419163 CAAAAGGTGTGTGAAGGTGCGGG + Intronic
953046568 3:39298356-39298378 CCGATGGTGTTTGCAGGCACTGG - Intergenic
954725107 3:52601693-52601715 GCACTGGTGTTAGCAGGTCCAGG + Intronic
955464669 3:59224354-59224376 CCAGAGTTGTGTTCAGGTCCTGG + Intergenic
956713970 3:72062203-72062225 CCAAAGGCATTTGTAGGTCAGGG - Intergenic
961006220 3:123407016-123407038 CCAAAGATGTCTGCAGGTCTGGG - Intronic
962378312 3:134876829-134876851 CCAAATGTGTTTGCCAGCCCTGG - Intronic
962946434 3:140174914-140174936 ATCAAGGTGTTGGCAGGTCCAGG + Intronic
965342156 3:167503835-167503857 CCAAAGGTGGTTGCCGTTGCCGG + Intronic
965521854 3:169675909-169675931 CCACAGGTATTTTCAGGTCTAGG - Intergenic
968671612 4:1855389-1855411 CCACAGGGGTTTGTAGGTGCTGG + Intronic
969206146 4:5647744-5647766 CCTAACGTGTTTGCAGTTCTGGG - Intronic
969722397 4:8899653-8899675 CAAAAGGTGTTGGCAGGTGCAGG + Intergenic
981699898 4:147597013-147597035 CAAATGGTGTTTCCAGGTGCAGG - Intergenic
987661751 5:20887401-20887423 CAAAAGTTGTATGCAGTTCCAGG + Intergenic
987781943 5:22449372-22449394 CAAAAGATGTATGCAGATCCTGG + Intronic
988761833 5:34317909-34317931 CAAAAGTTGTATGCAGTTCCAGG - Intergenic
988837257 5:35045688-35045710 CCAAAGGTTTTTGCAAGGCCAGG + Intronic
989265998 5:39474889-39474911 CCAAGAGTCTTTGCAGGTGCTGG - Intergenic
989563864 5:42881380-42881402 CCAAAGATGTTCCCAGGGCCTGG + Intronic
991979230 5:72214407-72214429 CCAAGGGTGTTTCCTGGTCATGG + Intergenic
992614363 5:78534827-78534849 CCACACATGTTGGCAGGTCCGGG - Intronic
993027327 5:82661740-82661762 CAAAAGGTTCTTGGAGGTCCTGG + Intergenic
993075617 5:83226425-83226447 CCCAAGGGGTTTGAAGTTCCTGG + Intronic
997782009 5:136668098-136668120 GCACTGGTGTTAGCAGGTCCAGG - Intergenic
999241343 5:150129645-150129667 CCAAAGGAGTTAGCATGCCCAGG - Intronic
1001768357 5:174272936-174272958 CCAAAGCTGTCTCCAGGCCCTGG + Intergenic
1003556908 6:7148144-7148166 ACAAAGGTGTTAGGAAGTCCTGG + Intronic
1005154319 6:22786500-22786522 ACAAAGCTTTTTGAAGGTCCTGG - Intergenic
1005225675 6:23639215-23639237 CAAAAGGTGTTTGGATTTCCTGG - Intergenic
1006558417 6:34889019-34889041 CCAAAGGTTTTGGGAGCTCCTGG - Intergenic
1007388688 6:41537101-41537123 CCAAGGGTGTTTCCACGGCCAGG - Intergenic
1007959413 6:45945460-45945482 CCAAAGTGTTTTGCAGGGCCAGG - Intronic
1008849098 6:56002906-56002928 CAAAATGTGTTTGCAGATACTGG + Intergenic
1009299808 6:62002205-62002227 CCAAAGGTGTTTGATATTCCTGG + Intronic
1016425816 6:143934882-143934904 GCACTGGTGTTAGCAGGTCCAGG + Intronic
1017183563 6:151577587-151577609 CTTGAGGTGTTTGCTGGTCCAGG + Intronic
1017801312 6:157898810-157898832 CCAAAGCAGGGTGCAGGTCCCGG + Intronic
1020024013 7:4885798-4885820 GAAAAGGTGTTTGAAGGTCAAGG - Intergenic
1022032322 7:26503743-26503765 CCAAACATGCTTGCAGGTCCCGG - Intergenic
1025478476 7:60956178-60956200 CCAAAGGTTTTTGCGGCTTCAGG + Intergenic
1026743106 7:72990969-72990991 CCAAAGGTCTCTGAAGGGCCAGG + Intergenic
1026802976 7:73411422-73411444 CCAAAGGTCTCTGAAGGGCCAGG + Intergenic
1027029221 7:74875673-74875695 CCAAAGGTCTCTGAAGGGCCAGG + Intergenic
1027100629 7:75374109-75374131 CCAAAGGTCTCTGAAGGGCCAGG - Intergenic
1027270920 7:76518269-76518291 CCACAGGCTTTTGCATGTCCTGG + Intergenic
1027452645 7:78350685-78350707 CCAAAGGTGGTCCCTGGTCCAGG + Intronic
1027744147 7:82052313-82052335 CTAAAGCTGTTTGAAAGTCCAGG - Intronic
1029850843 7:103460276-103460298 CCAAAGCTGATTTCAAGTCCTGG + Intergenic
1040702601 8:50085751-50085773 CCAAAGATGTTTACTGTTCCAGG - Intronic
1048008615 8:130438944-130438966 CCTAATGTGTTCCCAGGTCCTGG - Intronic
1048088186 8:131207788-131207810 CCAAAGCAGTGTGCAGGACCTGG - Intergenic
1048606970 8:135979047-135979069 CCTAAGGTGTTTGTATATCCAGG + Intergenic
1051437096 9:17044441-17044463 TCCCAGGTGTTTGCAGGTCTTGG - Intergenic
1051496729 9:17731739-17731761 CCAAAGGGGCTTGCAGGTTCTGG + Intronic
1057692524 9:97297880-97297902 CCAAAGGTGTCTGAAGACCCTGG + Intergenic
1058877299 9:109255615-109255637 CCAAAGGTGTTTGCAGGTCCTGG + Exonic
1062200036 9:135297776-135297798 CCAATGGTGTCAGCAGATCCAGG - Intergenic
1062550101 9:137082241-137082263 CCAGAGGCCTTTGCAGGTCCTGG + Intronic
1186762962 X:12742331-12742353 CCCAAGGAGTTTGCAGGGCTTGG + Intergenic
1198464552 X:136893078-136893100 CCAAAGGTGATTCCAGGTTTTGG + Intergenic
1198836775 X:140814567-140814589 CCAAAGGTGTGCAGAGGTCCAGG + Intergenic
1199002180 X:142652296-142652318 TCAAAGCTGGTTGCAGGCCCAGG + Intergenic
1200108313 X:153726274-153726296 CCAAAGGTGTGGGCAGGCCATGG + Intronic
1200327737 X:155260306-155260328 CCAAAGGTGTTTGCTGGGTTTGG - Exonic
1200375007 X:155770577-155770599 GCAAAGGTGATTACAGGTCTTGG - Intronic