ID: 1058878520

View in Genome Browser
Species Human (GRCh38)
Location 9:109265916-109265938
Sequence GCTAGAAGCAGCATTCATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058878519_1058878520 -5 Left 1058878519 9:109265898-109265920 CCAATCGCTTTGATGACAGCTAG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1058878520 9:109265916-109265938 GCTAGAAGCAGCATTCATAGAGG No data
1058878518_1058878520 8 Left 1058878518 9:109265885-109265907 CCTGGGTTAAAAACCAATCGCTT 0: 1
1: 0
2: 2
3: 3
4: 102
Right 1058878520 9:109265916-109265938 GCTAGAAGCAGCATTCATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058878520 Original CRISPR GCTAGAAGCAGCATTCATAG AGG Intronic
No off target data available for this crispr