ID: 1058880069

View in Genome Browser
Species Human (GRCh38)
Location 9:109278173-109278195
Sequence CGTCCACCGGACCCGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 41}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058880069_1058880074 -7 Left 1058880069 9:109278173-109278195 CCTTCTCCCGGGTCCGGTGGACG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1058880074 9:109278189-109278211 GTGGACGGAGTGAGAGTCTCTGG No data
1058880069_1058880077 17 Left 1058880069 9:109278173-109278195 CCTTCTCCCGGGTCCGGTGGACG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1058880077 9:109278213-109278235 TGAGAAATGAGAAGGAACCCGGG No data
1058880069_1058880080 28 Left 1058880069 9:109278173-109278195 CCTTCTCCCGGGTCCGGTGGACG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1058880080 9:109278224-109278246 AAGGAACCCGGGAGGGTTCGAGG No data
1058880069_1058880075 9 Left 1058880069 9:109278173-109278195 CCTTCTCCCGGGTCCGGTGGACG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1058880075 9:109278205-109278227 TCTCTGGCTGAGAAATGAGAAGG No data
1058880069_1058880078 20 Left 1058880069 9:109278173-109278195 CCTTCTCCCGGGTCCGGTGGACG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1058880078 9:109278216-109278238 GAAATGAGAAGGAACCCGGGAGG No data
1058880069_1058880079 21 Left 1058880069 9:109278173-109278195 CCTTCTCCCGGGTCCGGTGGACG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1058880079 9:109278217-109278239 AAATGAGAAGGAACCCGGGAGGG No data
1058880069_1058880076 16 Left 1058880069 9:109278173-109278195 CCTTCTCCCGGGTCCGGTGGACG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1058880076 9:109278212-109278234 CTGAGAAATGAGAAGGAACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058880069 Original CRISPR CGTCCACCGGACCCGGGAGA AGG (reversed) Intronic
902132230 1:14272255-14272277 AGTCCACAGGTCCCAGGAGAAGG - Intergenic
904622479 1:31783679-31783701 CGCCCACCAGTCTCGGGAGAGGG + Intergenic
907475465 1:54702276-54702298 CGCCCACAGGACCCGAGGGAGGG - Intronic
917096641 1:171404895-171404917 TGTCCACCGGACCCGGGGGTGGG + Intergenic
920674641 1:208030577-208030599 CGACCACAAGACCCGGGAGGAGG + Intronic
1076746712 10:132518190-132518212 CGTGAACCTGACCCTGGAGAGGG + Intergenic
1076902759 10:133347917-133347939 CCTCCACAGGAGCGGGGAGAGGG - Intronic
1114674205 14:24430131-24430153 CCTCCACCGCGCCCGGGAGCGGG + Intronic
1121339023 14:93094040-93094062 GCTCCACCGCTCCCGGGAGAAGG + Intronic
1122092201 14:99348132-99348154 CGTCGACAGGATCAGGGAGAGGG + Intergenic
1135437194 16:22437023-22437045 CGGCCAGCGGAGCCGGGAGGCGG + Intronic
1140281583 16:73559570-73559592 CAGCAACCGGACCCGAGAGAGGG - Intergenic
1148819729 17:50353651-50353673 CGGCCACTGGACCCTGGCGAGGG + Exonic
1148936240 17:51166419-51166441 CGACCACCACACCCGGGAGCCGG - Intronic
1149628873 17:58103433-58103455 CTTGAACCGGACCCGGGAGGTGG - Intergenic
1152728079 17:81957463-81957485 CATCTACCGGGCCCTGGAGAAGG + Intronic
1165745630 19:38228527-38228549 CCTCCACCAGGCCCGGGAGGAGG + Intronic
1167375296 19:49107899-49107921 CCTCCGCCGGTCCCGGGAGCGGG - Exonic
1167557545 19:50205525-50205547 CGCCGACCGGAGCGGGGAGATGG - Intronic
925838297 2:7966609-7966631 GGTCCACAGGACCAGGGAGATGG + Intergenic
925838315 2:7966684-7966706 GGTCCACAGGACCAGGGAGATGG + Intergenic
927195337 2:20542702-20542724 CGTCCACTGGGGCAGGGAGATGG + Intergenic
932287940 2:70552987-70553009 CGCAGACCCGACCCGGGAGAGGG + Intronic
932982877 2:76691230-76691252 AGTCCACCGGACCCTGACGATGG - Intergenic
946001783 2:216488527-216488549 TGTCCACAGGGCCCGGGTGAGGG - Intergenic
948870858 2:240797340-240797362 CAACCACCAGACCCCGGAGAAGG + Intronic
1171135960 20:22694575-22694597 GGTCCACAGAACCCGAGAGAAGG + Intergenic
1172513303 20:35515321-35515343 CATCCACCGGCCTCTGGAGATGG + Exonic
1173247388 20:41345971-41345993 CGTCCTGCGGTCGCGGGAGAAGG + Exonic
1175685068 20:61022903-61022925 CCTCCATCAGACCCGGGAGCTGG - Intergenic
1182084252 22:27550692-27550714 CCTCCACCTGACCCAGCAGAGGG + Intergenic
1182804355 22:33058015-33058037 CGTCTGCCGGGCCCGGGAGCCGG - Intronic
1185081627 22:48712662-48712684 CGTCCACCTGCCCCAGGCGAGGG + Intronic
982304534 4:153916426-153916448 CATCCACCGGCTCAGGGAGAAGG + Intergenic
984952958 4:185020055-185020077 CACCCACCCCACCCGGGAGAAGG - Intronic
997291281 5:132737425-132737447 CGTCCGCCGGGCACGGGAGGGGG - Exonic
997521758 5:134527647-134527669 CGACCGCCGGAGCCGGGAGGAGG - Intronic
1002784730 6:392421-392443 CGTCCGCCGGACCCCGGAGCAGG - Intronic
1005009363 6:21321477-21321499 CCTCCACCGGACCTGAGAGTGGG - Intergenic
1017485748 6:154900641-154900663 CTGCCACCGGACCTGTGAGAAGG + Intronic
1022111798 7:27236521-27236543 CGTCTTCCGGGCCCAGGAGAGGG + Intergenic
1040530665 8:48264046-48264068 TGTCCACCTGACCTGGGAGTGGG - Intergenic
1040995648 8:53399003-53399025 AATCCACCGAACGCGGGAGATGG + Intergenic
1049936610 9:505556-505578 GTTCCACGGGACCCGGGTGAAGG - Intronic
1054764987 9:69035850-69035872 CGGCCGCGGGACCCGGGTGAGGG - Exonic
1058880069 9:109278173-109278195 CGTCCACCGGACCCGGGAGAAGG - Intronic