ID: 1058884261

View in Genome Browser
Species Human (GRCh38)
Location 9:109311488-109311510
Sequence GCACCGGATGATCCCACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058884258_1058884261 6 Left 1058884258 9:109311459-109311481 CCGGGGGGACTGAGCTGGGTAAC 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1058884261 9:109311488-109311510 GCACCGGATGATCCCACAGGTGG No data
1058884253_1058884261 15 Left 1058884253 9:109311450-109311472 CCATTCCACCCGGGGGGACTGAG 0: 1
1: 0
2: 1
3: 16
4: 217
Right 1058884261 9:109311488-109311510 GCACCGGATGATCCCACAGGTGG No data
1058884257_1058884261 7 Left 1058884257 9:109311458-109311480 CCCGGGGGGACTGAGCTGGGTAA 0: 1
1: 0
2: 0
3: 16
4: 206
Right 1058884261 9:109311488-109311510 GCACCGGATGATCCCACAGGTGG No data
1058884255_1058884261 10 Left 1058884255 9:109311455-109311477 CCACCCGGGGGGACTGAGCTGGG 0: 1
1: 0
2: 1
3: 18
4: 278
Right 1058884261 9:109311488-109311510 GCACCGGATGATCCCACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058884261 Original CRISPR GCACCGGATGATCCCACAGG TGG Intronic
No off target data available for this crispr