ID: 1058885856

View in Genome Browser
Species Human (GRCh38)
Location 9:109320738-109320760
Sequence AGCCCCTCGGCAGCCCGCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 149}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058885856_1058885866 8 Left 1058885856 9:109320738-109320760 CCTGCGCGGGCTGCCGAGGGGCT 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1058885866 9:109320769-109320791 CGGGCGGCTGCGGGCTGCCAGGG 0: 1
1: 1
2: 1
3: 15
4: 249
1058885856_1058885865 7 Left 1058885856 9:109320738-109320760 CCTGCGCGGGCTGCCGAGGGGCT 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1058885865 9:109320768-109320790 ACGGGCGGCTGCGGGCTGCCAGG 0: 1
1: 0
2: 2
3: 19
4: 207
1058885856_1058885861 -8 Left 1058885856 9:109320738-109320760 CCTGCGCGGGCTGCCGAGGGGCT 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1058885861 9:109320753-109320775 GAGGGGCTGCTCCGGACGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 156
1058885856_1058885875 26 Left 1058885856 9:109320738-109320760 CCTGCGCGGGCTGCCGAGGGGCT 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1058885875 9:109320787-109320809 CAGGGGGCTGCCGGGGGCGCGGG 0: 1
1: 0
2: 5
3: 66
4: 685
1058885856_1058885876 29 Left 1058885856 9:109320738-109320760 CCTGCGCGGGCTGCCGAGGGGCT 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1058885876 9:109320790-109320812 GGGGCTGCCGGGGGCGCGGGAGG 0: 1
1: 2
2: 19
3: 211
4: 1592
1058885856_1058885871 19 Left 1058885856 9:109320738-109320760 CCTGCGCGGGCTGCCGAGGGGCT 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1058885871 9:109320780-109320802 GGGCTGCCAGGGGGCTGCCGGGG 0: 1
1: 0
2: 6
3: 64
4: 582
1058885856_1058885868 10 Left 1058885856 9:109320738-109320760 CCTGCGCGGGCTGCCGAGGGGCT 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1058885868 9:109320771-109320793 GGCGGCTGCGGGCTGCCAGGGGG 0: 1
1: 0
2: 1
3: 47
4: 393
1058885856_1058885874 25 Left 1058885856 9:109320738-109320760 CCTGCGCGGGCTGCCGAGGGGCT 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1058885874 9:109320786-109320808 CCAGGGGGCTGCCGGGGGCGCGG 0: 1
1: 0
2: 6
3: 80
4: 640
1058885856_1058885869 17 Left 1058885856 9:109320738-109320760 CCTGCGCGGGCTGCCGAGGGGCT 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1058885869 9:109320778-109320800 GCGGGCTGCCAGGGGGCTGCCGG 0: 1
1: 1
2: 4
3: 65
4: 511
1058885856_1058885872 20 Left 1058885856 9:109320738-109320760 CCTGCGCGGGCTGCCGAGGGGCT 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1058885872 9:109320781-109320803 GGCTGCCAGGGGGCTGCCGGGGG 0: 1
1: 0
2: 7
3: 60
4: 507
1058885856_1058885863 -1 Left 1058885856 9:109320738-109320760 CCTGCGCGGGCTGCCGAGGGGCT 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1058885863 9:109320760-109320782 TGCTCCGGACGGGCGGCTGCGGG 0: 1
1: 0
2: 1
3: 3
4: 107
1058885856_1058885862 -2 Left 1058885856 9:109320738-109320760 CCTGCGCGGGCTGCCGAGGGGCT 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1058885862 9:109320759-109320781 CTGCTCCGGACGGGCGGCTGCGG 0: 1
1: 0
2: 1
3: 8
4: 140
1058885856_1058885870 18 Left 1058885856 9:109320738-109320760 CCTGCGCGGGCTGCCGAGGGGCT 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1058885870 9:109320779-109320801 CGGGCTGCCAGGGGGCTGCCGGG 0: 1
1: 0
2: 3
3: 49
4: 481
1058885856_1058885867 9 Left 1058885856 9:109320738-109320760 CCTGCGCGGGCTGCCGAGGGGCT 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1058885867 9:109320770-109320792 GGGCGGCTGCGGGCTGCCAGGGG 0: 2
1: 0
2: 2
3: 46
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058885856 Original CRISPR AGCCCCTCGGCAGCCCGCGC AGG (reversed) Exonic