ID: 1058886046

View in Genome Browser
Species Human (GRCh38)
Location 9:109321700-109321722
Sequence CCTTGAACTTGTATACTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058886046_1058886055 27 Left 1058886046 9:109321700-109321722 CCCTCCAGTATACAAGTTCAAGG No data
Right 1058886055 9:109321750-109321772 GTGCTGCTAAATGAGGAATGTGG No data
1058886046_1058886051 -3 Left 1058886046 9:109321700-109321722 CCCTCCAGTATACAAGTTCAAGG No data
Right 1058886051 9:109321720-109321742 AGGTCCGCTTCGAGTGAAGAGGG No data
1058886046_1058886053 20 Left 1058886046 9:109321700-109321722 CCCTCCAGTATACAAGTTCAAGG No data
Right 1058886053 9:109321743-109321765 TTGACCAGTGCTGCTAAATGAGG No data
1058886046_1058886050 -4 Left 1058886046 9:109321700-109321722 CCCTCCAGTATACAAGTTCAAGG No data
Right 1058886050 9:109321719-109321741 AAGGTCCGCTTCGAGTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058886046 Original CRISPR CCTTGAACTTGTATACTGGA GGG (reversed) Intergenic