ID: 1058886049

View in Genome Browser
Species Human (GRCh38)
Location 9:109321704-109321726
Sequence CGGACCTTGAACTTGTATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058886049_1058886055 23 Left 1058886049 9:109321704-109321726 CCAGTATACAAGTTCAAGGTCCG No data
Right 1058886055 9:109321750-109321772 GTGCTGCTAAATGAGGAATGTGG No data
1058886049_1058886056 29 Left 1058886049 9:109321704-109321726 CCAGTATACAAGTTCAAGGTCCG No data
Right 1058886056 9:109321756-109321778 CTAAATGAGGAATGTGGAAGAGG No data
1058886049_1058886053 16 Left 1058886049 9:109321704-109321726 CCAGTATACAAGTTCAAGGTCCG No data
Right 1058886053 9:109321743-109321765 TTGACCAGTGCTGCTAAATGAGG No data
1058886049_1058886050 -8 Left 1058886049 9:109321704-109321726 CCAGTATACAAGTTCAAGGTCCG No data
Right 1058886050 9:109321719-109321741 AAGGTCCGCTTCGAGTGAAGAGG No data
1058886049_1058886051 -7 Left 1058886049 9:109321704-109321726 CCAGTATACAAGTTCAAGGTCCG No data
Right 1058886051 9:109321720-109321742 AGGTCCGCTTCGAGTGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058886049 Original CRISPR CGGACCTTGAACTTGTATAC TGG (reversed) Intergenic