ID: 1058886051

View in Genome Browser
Species Human (GRCh38)
Location 9:109321720-109321742
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058886048_1058886051 -4 Left 1058886048 9:109321701-109321723 CCTCCAGTATACAAGTTCAAGGT No data
Right 1058886051 9:109321720-109321742 AGGTCCGCTTCGAGTGAAGAGGG No data
1058886049_1058886051 -7 Left 1058886049 9:109321704-109321726 CCAGTATACAAGTTCAAGGTCCG No data
Right 1058886051 9:109321720-109321742 AGGTCCGCTTCGAGTGAAGAGGG No data
1058886046_1058886051 -3 Left 1058886046 9:109321700-109321722 CCCTCCAGTATACAAGTTCAAGG No data
Right 1058886051 9:109321720-109321742 AGGTCCGCTTCGAGTGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058886051 Original CRISPR AGGTCCGCTTCGAGTGAAGA GGG Intergenic