ID: 1058886051 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:109321720-109321742 |
| Sequence | AGGTCCGCTTCGAGTGAAGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1058886048_1058886051 | -4 | Left | 1058886048 | 9:109321701-109321723 | CCTCCAGTATACAAGTTCAAGGT | No data | ||
| Right | 1058886051 | 9:109321720-109321742 | AGGTCCGCTTCGAGTGAAGAGGG | No data | ||||
| 1058886049_1058886051 | -7 | Left | 1058886049 | 9:109321704-109321726 | CCAGTATACAAGTTCAAGGTCCG | No data | ||
| Right | 1058886051 | 9:109321720-109321742 | AGGTCCGCTTCGAGTGAAGAGGG | No data | ||||
| 1058886046_1058886051 | -3 | Left | 1058886046 | 9:109321700-109321722 | CCCTCCAGTATACAAGTTCAAGG | No data | ||
| Right | 1058886051 | 9:109321720-109321742 | AGGTCCGCTTCGAGTGAAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1058886051 | Original CRISPR | AGGTCCGCTTCGAGTGAAGA GGG | Intergenic | ||