ID: 1058886052

View in Genome Browser
Species Human (GRCh38)
Location 9:109321724-109321746
Sequence TCAACCCTCTTCACTCGAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058886052_1058886053 -4 Left 1058886052 9:109321724-109321746 CCGCTTCGAGTGAAGAGGGTTGA No data
Right 1058886053 9:109321743-109321765 TTGACCAGTGCTGCTAAATGAGG No data
1058886052_1058886055 3 Left 1058886052 9:109321724-109321746 CCGCTTCGAGTGAAGAGGGTTGA No data
Right 1058886055 9:109321750-109321772 GTGCTGCTAAATGAGGAATGTGG No data
1058886052_1058886057 23 Left 1058886052 9:109321724-109321746 CCGCTTCGAGTGAAGAGGGTTGA No data
Right 1058886057 9:109321770-109321792 TGGAAGAGGATGAAGCTGAAAGG No data
1058886052_1058886056 9 Left 1058886052 9:109321724-109321746 CCGCTTCGAGTGAAGAGGGTTGA No data
Right 1058886056 9:109321756-109321778 CTAAATGAGGAATGTGGAAGAGG No data
1058886052_1058886058 26 Left 1058886052 9:109321724-109321746 CCGCTTCGAGTGAAGAGGGTTGA No data
Right 1058886058 9:109321773-109321795 AAGAGGATGAAGCTGAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058886052 Original CRISPR TCAACCCTCTTCACTCGAAG CGG (reversed) Intergenic
No off target data available for this crispr