ID: 1058886053

View in Genome Browser
Species Human (GRCh38)
Location 9:109321743-109321765
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058886046_1058886053 20 Left 1058886046 9:109321700-109321722 CCCTCCAGTATACAAGTTCAAGG No data
Right 1058886053 9:109321743-109321765 TTGACCAGTGCTGCTAAATGAGG No data
1058886048_1058886053 19 Left 1058886048 9:109321701-109321723 CCTCCAGTATACAAGTTCAAGGT No data
Right 1058886053 9:109321743-109321765 TTGACCAGTGCTGCTAAATGAGG No data
1058886049_1058886053 16 Left 1058886049 9:109321704-109321726 CCAGTATACAAGTTCAAGGTCCG No data
Right 1058886053 9:109321743-109321765 TTGACCAGTGCTGCTAAATGAGG No data
1058886052_1058886053 -4 Left 1058886052 9:109321724-109321746 CCGCTTCGAGTGAAGAGGGTTGA No data
Right 1058886053 9:109321743-109321765 TTGACCAGTGCTGCTAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058886053 Original CRISPR TTGACCAGTGCTGCTAAATG AGG Intergenic