ID: 1058886352

View in Genome Browser
Species Human (GRCh38)
Location 9:109324286-109324308
Sequence ATTCACACTGGGCATAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058886352_1058886358 28 Left 1058886352 9:109324286-109324308 CCTCTTTTATGCCCAGTGTGAAT No data
Right 1058886358 9:109324337-109324359 ATCAATGCATTGCTCTTTTATGG No data
1058886352_1058886359 29 Left 1058886352 9:109324286-109324308 CCTCTTTTATGCCCAGTGTGAAT No data
Right 1058886359 9:109324338-109324360 TCAATGCATTGCTCTTTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058886352 Original CRISPR ATTCACACTGGGCATAAAAG AGG (reversed) Intergenic
No off target data available for this crispr