ID: 1058886791

View in Genome Browser
Species Human (GRCh38)
Location 9:109327721-109327743
Sequence GTACCCTCCTCAAGATCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058886791_1058886797 9 Left 1058886791 9:109327721-109327743 CCTGGTGATCTTGAGGAGGGTAC No data
Right 1058886797 9:109327753-109327775 AGGAAGGAATGGACTTATATGGG No data
1058886791_1058886795 -2 Left 1058886791 9:109327721-109327743 CCTGGTGATCTTGAGGAGGGTAC No data
Right 1058886795 9:109327742-109327764 ACAGTGGTACAAGGAAGGAATGG No data
1058886791_1058886794 -7 Left 1058886791 9:109327721-109327743 CCTGGTGATCTTGAGGAGGGTAC No data
Right 1058886794 9:109327737-109327759 AGGGTACAGTGGTACAAGGAAGG No data
1058886791_1058886796 8 Left 1058886791 9:109327721-109327743 CCTGGTGATCTTGAGGAGGGTAC No data
Right 1058886796 9:109327752-109327774 AAGGAAGGAATGGACTTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058886791 Original CRISPR GTACCCTCCTCAAGATCACC AGG (reversed) Intergenic
No off target data available for this crispr