ID: 1058892757

View in Genome Browser
Species Human (GRCh38)
Location 9:109374999-109375021
Sequence ATGGAGCTGTAGACTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058892746_1058892757 12 Left 1058892746 9:109374964-109374986 CCTCCCCTTGCCTCCCTCCTACT No data
Right 1058892757 9:109374999-109375021 ATGGAGCTGTAGACTGAGGATGG No data
1058892749_1058892757 7 Left 1058892749 9:109374969-109374991 CCTTGCCTCCCTCCTACTAGCTG No data
Right 1058892757 9:109374999-109375021 ATGGAGCTGTAGACTGAGGATGG No data
1058892751_1058892757 2 Left 1058892751 9:109374974-109374996 CCTCCCTCCTACTAGCTGGAATG No data
Right 1058892757 9:109374999-109375021 ATGGAGCTGTAGACTGAGGATGG No data
1058892755_1058892757 -5 Left 1058892755 9:109374981-109375003 CCTACTAGCTGGAATGTGATGGA No data
Right 1058892757 9:109374999-109375021 ATGGAGCTGTAGACTGAGGATGG No data
1058892747_1058892757 9 Left 1058892747 9:109374967-109374989 CCCCTTGCCTCCCTCCTACTAGC No data
Right 1058892757 9:109374999-109375021 ATGGAGCTGTAGACTGAGGATGG No data
1058892753_1058892757 -2 Left 1058892753 9:109374978-109375000 CCTCCTACTAGCTGGAATGTGAT No data
Right 1058892757 9:109374999-109375021 ATGGAGCTGTAGACTGAGGATGG No data
1058892752_1058892757 -1 Left 1058892752 9:109374977-109374999 CCCTCCTACTAGCTGGAATGTGA No data
Right 1058892757 9:109374999-109375021 ATGGAGCTGTAGACTGAGGATGG No data
1058892748_1058892757 8 Left 1058892748 9:109374968-109374990 CCCTTGCCTCCCTCCTACTAGCT No data
Right 1058892757 9:109374999-109375021 ATGGAGCTGTAGACTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058892757 Original CRISPR ATGGAGCTGTAGACTGAGGA TGG Intergenic
No off target data available for this crispr